GenePrediction:GLEAN_910 Details

Name: GLEAN_910
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_132:793468..795136 (+ strand)
Length: 1669
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_132:793468..793492 (+ strand)
Length: 25
Type: CDS
Source: GLEAN
Position: GCSC_132:793556..793591 (+ strand)
Length: 36
Type: CDS
Source: GLEAN
Position: GCSC_132:793654..793985 (+ strand)
Length: 332
Type: CDS
Source: GLEAN
Position: GCSC_132:794136..794220 (+ strand)
Length: 85
Type: CDS
Source: GLEAN
Position: GCSC_132:794268..795136 (+ strand)
Length: 869
>GLEAN_910 class=GenePrediction position=GCSC_132:793468..795136 (+ strand)
ATGACGACCCGATACCGTGTCGAGTGTGAGCCTTCCTTCGTCTGCTGTCATTGACGCCTCATGCCTTCTCGCTCCTGACG
ACTGCCAGATGCCCTCAAGTCGCACCGCCGGGATCAGCTGATCGGTAGGCCGCACTCCTTCTTGTTCCCGCCTCTCTCCT
CACTCTTCCTGACACCGCCCTCCCAGAATGGGTCAAGGGCCTGCTCATCAGCCCGTTTGTGCTCTTCTCGCAGCCGGCCG
GCGGCTTTGAAGATGTCGACGCCGTCTTTGCCGCCGACTCGGCCGAGGTACGGCGTCGCTACGCCGAGATCATGCGCGAC
ATCGAGACCATGGTGGCCGAGCATCGGCTGCTGCAGGGCGACGACCTGCTCGACAGCCGTCGTGATAGCTGGCCGCCGCC
ACGGCCGTCGCGCCTGCAGCTGCTCGTGCCCACCGTCGGGCCCTTCTTCACCCCGCTGCCGCTCGAGGCCGCCTTTCTCT
TCCAGGACCGTCGTCGCCGCATCTCGTCGCGCCGCCTGGTCGCCCCCTCCTTCAACGACATCCGCCTGACCCTCAACACG
GCTCAGATGATGGCCCTGACAGGACGCGACGATAGCAGCACCTCATCCTCGTCCTCGTCCTCGTCCTCGTCCTCGTCGTC
CTCTTTCACGTCCTTCCCTTCCCTGCAGCTCGTCACCTTTGATGGCGACCTGACCCTGTACGAGGACGGCCAGAATCTGG
AGCCGGACAGCCCGCTGATTCCACGGATCTTGGGTACGTAAAACACCAGCCCGACTGCCAGAGCCGCACTGACAACCCAG
AACTCCTCCGCCGCGACATCAAAGTCGGCATCGTCACGGCGGCTGGCTACGACACGGCCGACCGCTACTACGAGCGTCTG
CATGGGCTCTTGTGTGCTGTGCGTGACGCCGGACCAGACAGCCTGACCGATGCCCAGAAGCACGGTCTTGTCGTCGTCGG
CGGTGAGGCCAGCTTCGTCTTTGCCTACAGCCCCGACAGCCCGGCTCTGCTGGCGGCCGTGGCCCCGACCGTCTGGATGC
CCGACGCCATGAAGCAGTGGCCGGCCGACGACGTGGCCGAGCTGCTCGACCTGGCCGAGACGACGCTGCGCGCCTGCGTC
GAGCGTCTGCAGCTGCCGGCGACCGTTCTGCGCAAAGCCCGCGCCGTCGGCATTGTGCCGCTGGTAGCCGCCGGCGCGGC
CGTCTTTGGCCGCAGCAGCAACAGCCCTGGCTCGGCCATAGTGCCGGCGGCAGCCGCTCCCAAAACCAACATGTCACGTG
AGGGTCTTGAGGAGGTCGTTCTGACTGTCCAGAAGCGCCTTGAGGTCAGCGCGGCCGGTCGTGCTGGCCGCGTGCCGTTT
TGCGCCTTCAACGGTGGCCGCGACGTCTTTGTCGACATCGGCGACAAGAGCTGGGGCGTTCAGATCTGCCAGCACGCCCT
GCGCTTTCTCGGCGGATCCACCACCACACATACGGCCGCCCGTCCCGGCACCACCCTCCACGTCGGCGACCAGTTCCTCA
GCGCCGGCGCAAACGACTTCCGCGCTCGCCGCGCCGCTACCACCGCCTGGGTCGCTAACCCGGTTGAGACGTGCGCCCTG
CTGGACGAGCTGCTCTTCCATCTCGGCGGAGGAGCGCCTGGGCCGACGACGGATGCAGACGCGCTGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62