GenePrediction:GLEAN_912 Details

Name: GLEAN_912
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_132:809737..812722 (+ strand)
Length: 2986
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_132:809737..810259 (+ strand)
Length: 523
Type: CDS
Source: GLEAN
Position: GCSC_132:810313..812075 (+ strand)
Length: 1763
Type: CDS
Source: GLEAN
Position: GCSC_132:812129..812722 (+ strand)
Length: 594
>GLEAN_912 class=GenePrediction position=GCSC_132:809737..812722 (+ strand)
ATGGCCCGCCAGACCAGCGTGGCCCGGGCGGCGGCTGCCTCGCCGGCAGCTGCTGCTGCGGCGCCTCCGAAGAAGGCAGA
CAAGGACTACACGTCCGACGGCGTGGCCGACAACGACGTCTTTCTGCTGCCGTTTTCGGACTTCAAGATTTTGACGGCCA
TCACGGTGGTGTCGGCGCTCGTCCGGCTCTTCCGCATCTACCAGCCGAGCAGCGTGGTGTTTGACGAGGTGCACTTTGGC
GGGTTCGCGTCCAAGTACATCAAGGGCCGGTTCTTCATGGACGTGCACCCGCCGCTGGCCAAGCTGCTGATCACGCTGGC
CGGCTGGATGGCCGGATTCGATGGCGACTTTGACTTCAAGGACATTGGCAAGGACTACATCGAGCCGGGGGTGCCGTACG
TGTACATGCGGCTGTTTCCGGCCGTCTGCGGCATTCTGCTGGCGCCAACGATGTTTCTGACGCTCAAGGCGTCGGGCTGC
CGGTCCTCGACGGCGCTGATGGGCGCTGGCATGATTATCTTTGGTGAGTCTGCATTTCCTGCTCTGCTCTTGCTCTGATG
TCTCCTAACAGGTCAGAAAACGGTCTTCTCACGCAGGCTCGGCTGATCCTGCTCGACTCTCCCCTAATGATCGCGACGGC
CTTTACCGGACTCTCGTTCACGGCCTTTACGAACCAGCACGAGCTGGGCCCATCCAAGGCATTCGAGCCCAGCTGGTGGT
TCTGGCTCTTCATGACGGGCCTCGGGCTTGGCATCACGACCAGCATCAAGTGGGTGGGCTTCTTCACGATCGCGTGGGTG
GGCTTGCTCACACTGGTGCAGCTCTGGGTGCTGCTGGGCGACGCAAAGCACGTCACGGTGCGGCTGCTGGCGAAGCACTT
TATGGCACGGGCGTTCTGCCTGATCGTGGTGCCGGTGACGTTCTACATGGCAATGTTCGGGATCCACTTCCTCTGCCTGG
TCAACCCGGGCGACGGTGACGGGTTCATGAGCTCGGAGTTCCAGGCGACGCTCAACTCCAAGGGCATGGCGGACACGCCA
GCGGACGTGTTGCTCGGCAGTGCGGTGACGATCCGGCACGTCAACACGCAGGGCGGCTACCTGCACTCGCACCCGCTGAT
GTACCCGACGGGTAGCAAGCAGCAACAGGTGACGCTGTACCCGCACAAGGACATCAACAACGTGTGGATCCTGGAGAACC
AGACGCAGCCGCTCGGTGCGGACGGCGAGACGATCAACGGGACGGATGCTTGGAACACGCTGCCGGCCGAGGGCGCGGAG
CTGCCGTACATCTACGACGGGATGACGCTGCGGATCTTCCACCAGGCGACGGCACGACGGCTGCACTCGCACGACGTGCG
GGCACCGGTTACAGAGGCGGACTGGCAGAACGAGGTGTCGGCATACGGATACGAAGGCTTTGACGGCGACGCGAACGACT
ACTTCCGGGTAGAGATTGTGAAAAAGTCATCCGACGGCGAAGTGGCCAAGACGCGGCTGCGCACGATCGAGACCAAGTTC
CAGCTGGTGCACATCATGACGGGCTGCCTGCTGTTCTCGCACAAGGTCAAGCTGCCGGACTGGGCGTCGGAGCAGCAGGA
GGTGGTGTGCGCACGGGGAGGCAGCCTGCCGAACAGCCTCTGGTACGTGGAGTCGAACGAGCACGCGCTGCTGGGGCCGG
AGGCCGAGAAGGCCAACTACCGGCAGCCGGGGTTCTTTGGCAAGTTCCTGGAGCTGCAGGCGGTGATGTGGAAGACGAAC
GCCGGGCTGGTGGAATCGCACGCGTACGAGTCGCGGCCGAGCTCGTGGCCGCTGCTGCAGCGCGGGATCAACTTCTGGGG
CCAGAACCACCGGCAGATCTACCTGATCGGCAACCCGTTTGTGTGGTGGAGCGCGACGGCGGCAGTGGTGGCGTACGTGT
TGTTCAAGGGCGTGGCCGTGCTGCGATGGCAGCGCAGCTGCGGCGACTACGCGGACGCGACGTTCAAGCGATTCGACTAT
GAGATCGGCACGTCGGTGCTGGCCTGGGCGCTGCACTTTTTCCCCTTCTACCTGATGCAGCGGCAGCTCTTCCTGCACCA
CTACTTCCCGGCGCTGTACTTTGGTATCATGGCGTTCTGCCAGATCTACGACTACGCGACAGCACGCAACCGACTGCTGC
GGCCGCAGGAGAAGGCAGTGGTCAACACAGCGGGCGCGATTGGCGTGCTGGTGCTGTCGGCCGTGGTGTTCTCGCTGTTT
GCGCCGCTGGCGTACGGCAATGTGTGGACGAAGGAGGATTGCCGGCGCGTGAAGCTGTTTGACACGTGGGACTGGGACTG
CAGCAGCTTTCTGGACACAGTGAGTGGGGAATTGATATGAGTGAATGATTGAAGCCAGGACTAACGAAATAGTACGAGGC
ATACGACTCGCAAGCACTCGTGGCGGCTGTTCCGACGACGGCCGTAGAGGCAGCACCGGTTGCAGGAGAGGCAGTAGCAG
CAGTTGGTGAGCTGGAGCAGGAGCAGGTGCCGATGGGTGACGACAAGGCAGCAGAGCGGGCAGCACCGCCACCGGCAGAC
ATCTCGGAAGCACCGTCAGCACCACCGGCGGAGAAGCTGCTGGCAAAGACGTTGTTATCACGTGAGCAGCGAGTGGAATA
CCGCGACCAAGACGGCAACGTGCTGGACGACAAGCAGGTGGAGGCGCTGCGCGGAAAGGTGGAATTTAAGACGCGCTACG
AGACGCGGACAAGGCTGGTGGACACAGCCGGAAACGTGGTCCAAGACGCGGTGGTTGACAGCGGCGATGTAGCCGCTGGT
GAGGAGGCCGTAGCTGTGGCACCACCGCATCCCGATGTCGAGGGTGTGGACCAGTCGACACGGCAGACGGCAGCCGAGGA
AAAGCAGCCGCAGAGCGTGGAGCCAAGCGTGGAAGGCGAGCGGGAGGCAGAGCAGAACCGTGCTCGACCGGCCAGCGAAA
GCAACGAGGCAACGGTGAAAGAGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62