GenePrediction:GLEAN_913 Details

Name: GLEAN_913
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_132:820338..821886 (+ strand)
Length: 1549
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_132:820338..820516 (+ strand)
Length: 179
Type: CDS
Source: GLEAN
Position: GCSC_132:820734..821270 (+ strand)
Length: 537
Type: CDS
Source: GLEAN
Position: GCSC_132:821343..821426 (+ strand)
Length: 84
Type: CDS
Source: GLEAN
Position: GCSC_132:821760..821886 (+ strand)
Length: 127
>GLEAN_913 class=GenePrediction position=GCSC_132:820338..821886 (+ strand)
ATGACTACGCCCCGTGTCTTCATCATCCGCCACGGCGAGACCGAGTGGTCGCTCAGTGGTCGACATACCGGAGTCACTGA
TATCCCATTGACGGCCAATGGAGAGCGGCGAATCATGGCCACTGGCCGGGCAATGGTTGGCAAGGACCGGCTGATTGTTC
CCAAGAAGCTGGCTCACATGTGAGTGTTTTGTTCTTTGTTCTTTTTTTTTCCTCGCTTCGCTCGATCTTTTCCTTCTTTC
CTCGCTTCGCTCAATCTTTTTTTTCTTTCCTCGCTTCGCTCGATTCTTTTCTTTCTTTGCTTTGTTCGATTGTGTTCTAT
TCTCCTCTTGTCGATTTCTTTTACTTCTTGGTCTTCTCTCCTCGCTTCCTCCCTGTTCGTCCGCTCATCCTCACAGCTAC
GTCTCTCCCCGTCGCCGTGCCCAACGCACCTTTGAGCTCCTTCATCTCGACCTCCCCGAACCGCTTCCGTGGCAGTGTCA
CGGCTCCTCCGACGGCCGCACCTCGCCACCGCACCTCTGCAATGCCCGGGTCGAGATCGCGCCCGACGTGCGCGAGTGGG
ACTACGGCGACTACGAGGGCATCACATCGCCCGAGATCCGGGCCAAACGTGTTGCTCAGGGCATCCCTGGCCGCTGGGAC
ATTTGGCGTGATGGCTGTCCCGGAGGCGAGTCACCCGCCGAGATCACAGACCGGCTCGACGCCCTGATTGCCGACCTTCG
CGAGCGCTTCCACAAGCCCGCACTCGAGGCCATGGTCAAGGCCAAGACTACCGGCACCAAGGCGGCCAAGGACGCTTCTG
CCTCTCTTGCTGGTGACGTCCTCATCGTCGCCCACGGACACATCCTGCGGGCCCTGGCCATGCGTTGGGTCGGTGCTGCA
CTGCAGGACGGGCCGACCTTCCTTCTCGAGGCCGGCGGCATCGGAACACTGAGGTAAATTCCAGAGCGCAAAAAAGCGAG
CGAAGCGAGGACCAAAAATAAAAGGCCGTCACTGACGTACCACAGCTACGAACACAACAACATCGAAGAGCCGGCCATCC
TTCTGGGCGGTGCCTTCACAGTCGATCTGGATACGGATGGCGAAGAGAAGTGAGCGAAGCGGAAGGAGAGAAGAAACCCG
GACAGAGACGGTACGTGTAGGTGCCTCATGTCGCAGGGAAATTGGGACGTAGGATCAAGATCGATCCCTTTAGATGGAGT
ACATACAGAATAGATCTAGGGGCGCTGGCCACTTCACTTCACGGCAAGACCGGCATTGGAGAATCAGGAATTCTTTTTTT
CTCTGGACATTGTTCCAGTTCGGTGCCTCCGGTCAGAGTCCGGCCCGCTGTTCTGTCTTCTGTTGGTCTACTCTGTACAA
GTAGCAGCTTTTTTCGTGGACCGTCTCTGCTACAATATCCGGTGATCAGGCTGGCGAAGCAGCCAGGCACTTGCCATGGC
ACTCGCTCGTATCTCCGTCGGCCGGGTCAACCTGGGTAGCTCGGGCGGAGATGTTACGGAGTGGAATGGGGGTGGAGAGA
AGGCGGAGTGGACCGACAGTGAGATCTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62