GenePrediction:GLEAN_914 Details

Name: GLEAN_914
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_132:828605..826447 (- strand)
Length: 2159
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_132:828605..828148 (- strand)
Length: 458
Type: CDS
Source: GLEAN
Position: GCSC_132:828071..827974 (- strand)
Length: 98
Type: CDS
Source: GLEAN
Position: GCSC_132:827134..826533 (- strand)
Length: 602
Type: CDS
Source: GLEAN
Position: GCSC_132:826473..826447 (- strand)
Length: 27
>GLEAN_914 class=GenePrediction position=GCSC_132:828605..826447 (- strand)
ATGCGAGCGCGGGAAAGTGGAAGGACAAAGACCGAGCAGGCAGCGGCGCGCACGAACCGCCTCCCTCCACTGCAGCCCGG
GTGGCAGCGCGCTCTTGTTTCAGGCAGCGGCACTACCATTTGTGTCACACCAACAAGTAGCGATCCCAGATCAGCACGAC
GCGGGAGTGTGGCGACGGACGAGAGAGGGCCCTTCGATGACCCATTGCGGGACAACGGGCCATCTAGCGGGCCCACGGCT
GAGGCCGCGAGCTACTTTGTACTTGCGCGTGTTTGTGCCTCGTACGAGGTACGCGCATCAGGCATTTCCCCCCTCGCAAG
CGACCTGACAGCGGCAGCGTGCAGTGGTGTTCCTGACCGGCCGGCCATGGCCCAACCGTCCAACTGCGGCCCTGGCCTCT
ACGGGGCTTTTCATCGAGAACGCTGGCCCGGGAGCACAACGCCCGAGAGCACAGCCTGGTACGGAGTACTGGTACAAGCC
CCATACAAGTCTGCATGTCTGCATACTATGTATCTACATGGTACATGTCTGCAGGCCTGCAATAGTGCTCGCCCACCGGA
AGCAGGGAGGGGGAGCTAGGCCGGTGGAGCAGCCCGGACGATTTGCTCATATTCCTTCTGTCTCGCCCACTGGTAAGGCA
ACATTGTGGCCAGTCGTCTCCGAGCACCACCCGTCTGTCTCGCCCTCTTCCTCTGCTGTTCTTCCGGCCAAGCTAGGCGT
CGCGCGGCACCCCAAAAAGGCTCTCTCATCGCCGGTGGCCGGGTGTCCACAAATAATACCTGAATCCTGGAAACGTGGCC
AATATTCTCGGCATGGACGCTGCCGTCTTACAGCTCTGAAACGTCCTGCTAGGCCGCCCTGGTCCTACAGCCATCTGTCT
GCCTTTCTTGCAGCGGGAATGCCGTGCGATGACAGCTGCTGCTGTGAACAGAAAAAGGCCGGTCTCGTGCAACGATACAA
TCGTCTTTGAATCTGACAGCTTGCCCATGTCCGCTGGCCGGACAGCTGTGTGGAACGCCGCATGTGGGCGTGTCAAGACG
ACATGCCATGCACACGATGGGGTAGAAAGGGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAAAAGCAAAAAAAAGAAAAAG
AAGCCGAGGCCAAAATCACGGCCACGACCATGCCGCTTTCAGCGATCACATACCCCGTCTGCATGAGAGCGGAGGCTAAA
ACAAGAAAGGTGCAACAAGTAAGATCACAGTATCTTATAAGCATAGTGCAATGATATCCTATCACATATGAGTACGGAGC
ACATCGTCCCGGGGTCAACAGAAAAAGGATTTCCGGAGTCGGCCGTCTGACATCGTCTGCAAGCATTGGAATCTTACCGC
TCGGCGCGTATTTCGCCTCGCCTTGCTACCAGGCAAGGATGAAGGCCCAAATGAGGCTGTGTGCCTGTTTGATGGTATGA
TTTTCTTTTTCCTCAGACTCTCCTACCACAGTTCGCCACGACGCAGGTATCGAGTACTTTCTTCCCCCTCCAGTTAACAG
GGCCTTCCGGAAACCGTCTGCCAACCAACAGCAACGAGCGGCCGAACCGACGGCTGCACCCTGCTGGCATTCTGGTATTA
GCGCATTTGTACGCAGATGCCATTGGGTGCGGCCATTCTCACCTGCATCCGTGTTGGGTTCCCGTCAGCGTTCCTCGTCA
TGGCGGCCAGAGTATGCTCGTACACGTTACCGACACGATGCGGACACCCTGTCGTCCCACCCTGCTGCCCGTCCCTTCTT
TCGTTCCCTCCCGCTCCTGCACACCAAGACGACGGCAAACAGCCCTCTTCAGCCCGCAAGCACATCCACCTGCCTGCTCT
GTATCTTCACTCAGGTGATCTCCCGCGGAGGGAGGCTCGGGCCCACCCTATGCCTACGAGTACGATACGATACGCGGGAT
AGAGTCAAGGGTGGCCGCTGGTGGGGTGGCAGGCCGGAACAGAAGAAGGCGATCAGCGAGACTTCGTATACGAGCAGCAG
CTACTATGTGCAATGCTCCGTACGGGGTACGAGCACGGATGGCAGGGTCGCCGATGCACTGCTCGGACGAGGCGTAATGA
CAAAAACACAGCCGTCAGACTGCTGATGCAAGTCGACATGTCCCATTTGCAGCCCCTTCACAACCCGTCACATGCCTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62