GenePrediction:GLEAN_915 Details

Name: GLEAN_915
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_132:829219..829998 (+ strand)
Length: 780
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_132:829219..829356 (+ strand)
Length: 138
Type: CDS
Source: GLEAN
Position: GCSC_132:829684..829998 (+ strand)
Length: 315
>GLEAN_915 class=GenePrediction position=GCSC_132:829219..829998 (+ strand)
ATGTCCATCCGGACTGCCCACCACGAACAGACAGCAGACAGCACATCGATCGAATGGACGCCCCCCTCCCTGGGCCCTGG
GTGGGACTGCTTCCCGCAAACACGGGCGGAACGTTCCTCGCTCCTTACGACGTACGGAGTATGTCCATGTGGCTCCACTA
CAACACTGGTCACCCCCCGTATTCGATACCGATCGGAGAGCGATAACCATCCGTGTGTACGGAAGCTTCTGCTGTTCCTT
GTTTTAAAATAGCAACGTGCCATGGTGCCCGCCGCGCTCAGTACGTAAGGATCGTGGCGAGGAGGAGCTTTCGCGCGGCC
ATACGTCACCTTGGACAATTTCTGGTGGCAACACGCGCTTTATTTTGTGGCATCCCGCGCAGGGAAGCCGGCCAATCCGC
TGCTCGTCCTGTTCGAGTGAGGCAGAACGCGTCCAGTACGGTCGTATCGTGCATACGAGCAATAGCCTCAGCCGGACGAG
AGCGGAACTGGCAGGACGGAGCAGCAGACAAGCTCACCGCCTTGTGGTGTCACCTGCCTGCATGCAAGCGAAGTCCTGCG
GCTGGCTGGCAGCCTGTCAATGCCACGGACACCACTGGACCAGACCATCACAGCCGGCACAGCACAAGACACAAAGCACA
AAGCAGGCAGTCTCGAAACGATGCCGGTGGTCGAGGTGAAGCCGCCCGATTGGCCGGACCGCCTGGCAAGCCTGCCCCGT
CCCGTGCCGACCAGAAGAGGGGAGGGAAAGACAGGGGACCAGGGTGTGTTCTGGTGCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62