GenePrediction:GLEAN_916 Details

Name: GLEAN_916
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_132:833116..834902 (+ strand)
Length: 1787
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_132:833116..833694 (+ strand)
Length: 579
Type: CDS
Source: GLEAN
Position: GCSC_132:833768..834528 (+ strand)
Length: 761
Type: CDS
Source: GLEAN
Position: GCSC_132:834617..834902 (+ strand)
Length: 286
>GLEAN_916 class=GenePrediction position=GCSC_132:833116..834902 (+ strand)
ATGGCTGAAGAGGTACGGCCAAAACTGGCCCAGATCCCCCAGGGCCGTGATGTGCCTTCTCTCGCCGGCGTTCCCAAACA
AGAGGATGACGACCAGGACCGTCGCCACCGTCCGCAGCCGCTGCAGCTGCCGGCCAACACCGTGACCTTGCCTTCGTTTC
GCGAGGCCTACGGCTCCGCTCTGGCGCAATATCCTGCCCCTCCCCCTCCACCAGCTCACCAGCCGTATGTCGACCAGATG
GGCCGGCCAGGACCACGGCCGCCGTATCCCGACTCTCCGAACAGCTCTGGCAGACTTGGTCCTCAGGGCCCGCCCGGTCC
TCTGGGTCCTCCCGGGCCTATGAATGGCGGTGGCGATATGCACTACGCCCCTCGGCTTCACGCTCCCGACGTGGCCAGCC
GCGAAAACAAGGACTACTACGGCGGCTACCCGTACAACCCTTATGCAGACCGCGCTCCTCCTCCCCATCCGTCATACTGG
GCCCAGCACCCAATGCCTCCCAACTACCAGTCCCAGCCGCCTGAGTCGGCTCCGCGGCAGAGAACTTCGATTGCGTGCAA
ATACTGCCGCAAGCGAAAGGTGTGTACTCGCTTTCTATTGTGCTTGTGCTGCTGCTTGTTCCAGTGTTTTTGTGTGTCTG
ACTCGTGGACAGATCCGTTGCAGTGGCTACCAGAACACACCAGACGGCAAGTGCACCAACTGCAAGAAGACCGGAAATGA
CTGTGTCTTCCAGCCGGTCTCGTCCACCACCTCGACTGCCTTTGTCCCGGTGTCTGCCATCCAGGGCGGCGTGCCACCGG
GTACCCCACTGTACGGCGCTTTCGGACAGCCATTGGGCCCGAACGGCGGCCGTGGACCGGCACCTGCGAACGGTCCTCCT
GGTGGACCCAATGGCCCGAACGGCGGTCACGGAGGCATGAACGGGGGCGGCGGACCGCCTCCTGGCTACGGCCCGAACTC
GCCGGGCGGCGGGGGCTACTACCAGCAGCAGCATCTGCCATCGCCCATGGACCAGAACGGCCCGCCACAGCAGCTTCCTC
CCTCGTCTCAGGGACCTCCATCGTCAGCAATGAGCATGCGCCAGCTACCACTTCCCTATCCCCAGCCCAACAACGGCTAC
CCTGGCGAGGATCAGCGAAGACGCAACAGCAAACGTCCTCGGGAAGACGAGGAGGCCGAATACTCGAACCGACTCCCTCC
TCCGGCGCCGGGCTATTCAAATCACAGCAACAACGGATACTACGGTGGTCCCGACGAGCTGGCTCGTGCTCATGGCGACA
TGAACGTAAACCGGCACTCGCCGCCGTCGATGCACGGCTCCAGCGTGCCGCTGTCTTCGGGCTCGCCGACCAACGGCCAT
CACGGTTACGGCCCTCTTCCGCCACCGCCACCCATGTCTTCCGTTGGGACTGAGTACGTGATCCGTATGGACCGCAGCGC
GGCAGCGCAGCAGAAGCAGAAGCAGCAGCAGCAGTCGAGCTAACAAGTGAGATTCAAGCAGTACCAGCGTGCGTAGCAAT
GGCAGTGCTGCCGGAACTGCTGCGACGTCACCGATTGAGCAGAGTGGGGCGAGATCGCCCAGCAGCGAAGCGGAAGACAA
AGCGAGGGGACAGGCTGCTGGCTGGCACCTGCAGCAGCCGCACACGTTTGCACGTGAATGCGATCTCGGCGCTGGGCGCG
ACATGGACCGCTTTATGCTGAACCGACTGGGCAGCGCTCGCCCCGACCCACGTCCCGACTACGTCGCCGACCAGGCGCAG
GCACATCTTCTCCGCGAGAGGGTGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62