GenePrediction:GLEAN_917 Details

Name: GLEAN_917
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_132:856947..865104 (+ strand)
Length: 8158
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_132:856947..857099 (+ strand)
Length: 153
Type: CDS
Source: GLEAN
Position: GCSC_132:857149..857232 (+ strand)
Length: 84
Type: CDS
Source: GLEAN
Position: GCSC_132:857284..857644 (+ strand)
Length: 361
Type: CDS
Source: GLEAN
Position: GCSC_132:857712..857822 (+ strand)
Length: 111
Type: CDS
Source: GLEAN
Position: GCSC_132:857884..858320 (+ strand)
Length: 437
Type: CDS
Source: GLEAN
Position: GCSC_132:858386..858753 (+ strand)
Length: 368
Type: CDS
Source: GLEAN
Position: GCSC_132:861658..862432 (+ strand)
Length: 775
Type: CDS
Source: GLEAN
Position: GCSC_132:862483..864369 (+ strand)
Length: 1887
Type: CDS
Source: GLEAN
Position: GCSC_132:864502..865104 (+ strand)
Length: 603
>GLEAN_917 class=GenePrediction position=GCSC_132:856947..865104 (+ strand)
ATGAACGAAACAAAGAAGATCGTCGCTGTCGACACCGAGCGGCTGGACACCAGCCAAGAGCACTCGGACAAGGCCGAGGC
GCCCTTTGTCAAGCACACCAAAGAGGGCTTTCTTTTAGTGCCCCAGCCGAGCGATGACCCAGACGATCCACTGGTAAGGA
ACGCGTCGATCAGCACAGATACGTCCCGATGCTGACCCTCAGAACTGGAGCTTCTCCAAGAAGCATGTCGCCTTGTTCTT
TCTCGCTATGGAGTCGCTGCTGGTCAAGTTCTCGGCCACCCTGATTGTGAGTATAATCTGACGATAAGAGTGAGGAACAA
CAGCTGACACCATTCAGTCTCCCGGCGCCCGCACTCTGGCCCACCTCTTCCATGTTCCCCTCTCCAAGGCCACCTATATC
GGCTCCGCGCCCACCATCATGAACGCCGTCGGCCCCTTCTTCTGGATCCCCATCAGCCACCGGATCGGGCGCCGTCCCGT
CCTCCTGATGAGTCAGATCATCGCTATGGTCGCTGCCATCGGTGTCGGTCGCTCCGAGACCTACGCCCAGGCCCTCGGCT
GTCGTATGGTCATGGGTTTCGGCGGAAGCGCTGGCCTGTGCATCGGTCCCGCTGCTATTTCGGATATGTTTTTTTTGCAC
GAAAAGGGAACCCGCATGGGCATCCAAAGCATCTTGCTAGTCGTCGCTCCGTATGTCGGTATGTTTTGTTCTCTCGTTCA
TATTCTCGGTTTTCTCCTCTGATTTCTCCCGTCTAACTCCTCCAGGCGGTGTTGCTGGTGGCTCCATTCAGTACAACTCC
AAACTCGGCTGGCGATGGTCTATGTACGTCTCTGCCATCTGCTACTCGGCCCAATTTGTCTGCCAGTTCTTCTTTGGTGA
GTGCTCTTTCATTCTCTCTCCTTCTGTCGTTTCGAAGACTTCGCTGACACAAGACAGTGCCCGAGACCATCTACGAGCGT
GAAGTCGCCGCGGCCGAGTTGCCCGAGCAGAAAAAGACGATCTGGCGCCGTCTCGGCTTCCGCATGCCCACGAACCCCTC
GGGCGAGACCTGGCTGCAGACCTTCCGCCGCCCCTTTGTCATGTTTGCCTACCCGGCTGTCGTGCTGCCGTCCTTCTGGG
CCTCCGTCGCCGTCATGACCGAGGTCGCCAACACGGCCGGATTTGCCATCAACTTTGGTGCCAGCAGCCGCTTCCACTTC
AACACCGCCCAGGTCGGCTTCTGCTTCATCTCCGGCCTCATCGGAGCCTTTACTGGCGAGGTGTGCGCCGGACCGCTCTG
TGACATGGCCGTCAGGAACTCGTTGCGCCGCAATCAGGTCTGGCGCGCCGAGAAGCTGCTAAAGCTGGCCATCACCGGAC
TTGTCACGATATTTGTAAGTTTCGGCTCCGAGACCTTTTCGTCTCTCAAATTCATTATTTTTCCCACACTGACCTGCAGG
CCGGCCTCATGCTTTACGGCTTTGAGCTTGAGAGCAGCAAGGCCTGGGCTCGTCCCCTCGCCGGCATGATCCTCTTCGTC
TTCGGCCAGGAGGTCGTCGTCACCATCATCATGACATACATGACCGACTGCTATCCTGAACATGCTGCCGAGGTCGCCGT
CGTCTTCCAGTTCTTCTTCAACCTCATGTGCTACCACCCGCCGTTTTACACACCCCAGTGGATCGCCAGTGCAGGCTCTA
AGGTTCCGTACATTGTGTATGCTGTCCTTCCAGTCGGCCTGTTTCCTATCCTGATCGGTCCGTTTATGTGGAAAGGCTCT
CAGATTCGTGAAAAGGGCCCTCTTTTCAGATTCATTTCCTTCAAAAGGTAGGATCATATTGTGCTTTGTTCTCAAGCAAT
TCTTGTTGTATCTGGTTGACAGGAAGGAGCTATGAGCGGATGAATTTCGTTTCCACAACGAATTCTTTGTATGATGCTTT
GGGCTTTGTCTGCTTTGTATATATGACTAAAGTGGTGATCGCTTGTGCCTGACTTAATAGTATCCTACAATTTAGAGTGC
ATAATGCGGATCGTAAAGGTAGCTGTGTAAATACTATGTCGATACACCTGTTGTAATAAATATAAGATGAATAAGAAGAA
CATCGATTAAAAAGGATGAGCGGGACAAAGTCGACAAGAGGCAGATGTTGAATAAAGAATTAGTATATAACCCTGCTTAG
CACGCTGTAAGGTATGGGATCCATACGTTTACTGGAGCAGGGGGGTAACGAAAGAGCAGCAGGCATAAGCCCGGTTGCCT
TTTCTTACACCAACCAAGTTGCTACTCCCACAACCCTACAACAGAAAGCCACGCGGTTCGGGCCCACGCCAAATCAAAAG
TTTGCCACAGCCAACTCACACAGCAGGGTAGAATAGTCTGTATCTATTAGACAACTCGGCACCCTTCGATACTTAGTCTG
ATTTCGCTTACTTGACCAATCTCCAGCTTTTCGCTTCGCTGATCTGCTCTTGGGAACCGCTCTGCTCCCAGAACTCTGCA
GCCGACCACGTCTGTAAGCATTTCGTCAAGCCTATCACGTGATTTAGAGCCATTGGATGCTTGTCTTCACAGACCTGGAA
CTGCACAAAGTCTACTGATATGATATGAGACCGATCTCTGCGCTGTCGGCTACCTAGGGGGGGTGTCGAAATCATTGAAA
AGCAGAAGTGAGAGCTGCCGACGGCTACGAAGATGGGTACATCAGGGTTAGTAGCTTGTTTTCTGTCCCCGTCCCGCTAC
GTGCTTGTCTTTATTGACGTACACTCCAGAGAATTCTCCTTGGACGGCGACGGGATGCGCCACTCTGTCACCATCCTGGT
TTTTTTCGTTACGCTCAGAACTATGTTCTTCGTATTAGTGCTCTATATAATATACCGTGCGTCCAGTGCTGAGGCACTGG
CACGGGTTGTCTCTGCTTTGAGCGGCGTCAATGGCAAGGACGACCTATAAGGAAGGTTGCAAAGGCTGATAATGTTACAG
GGGCTGGTGTCTTGAATAGACGATTGTGGTTGTCGACGGCGGCATACCCCTGGTTTCGAGCCGATTTGTTTACATGTCTG
ACCTGAAGATTCGGGCTCTTTGTTTTGGAAACACTGCCAGGACTTGTGGCGCCACGATGGCAGTCGTGACGACGCTTATG
GATCCATGGAGTACCAACAGAAGTCTGTGTTCTGGAAAGCAATAATAAAAATAAGAGTTTAGTCCGCTTAAGCAGCTTAC
TAGCCCTTGATGTTTCGAGGATCAGGACACGTCCAAGCCAACAACGATTCTACAGGAAAACTCAAAAATAAATAAAAAAC
GGTCATCTCATACACATGTATGGATCTAATGATAAATATCAAACTAAAGGCAAGGATGCGAGAAGAGGTATCCCCAGAAA
GGAGAAGGATAGAGGAACAACACAGCTTCGAGGCCAAGATATGTAAGAAGGAAAACCGCAAAAACAAAGCAAAGGCGCTA
TCTTTTCAAACCATGCCCCTCGATATGTGCGTTGGAACAGGTTTACTAACTACTGTACTATGGTAATCTATATAAGGGTG
GCCGGCTGTTGTGGACGCTAAGGACCGCTAAATGGGCTTTACTATCACATTTGAGCACATTAAGAACTAGATGTTATATA
TTTCGCATTCAAATGATGAAACAAAACCTGGGGATGACTCGATTGCTGCTGAGTTTGTGTTTAAGAAGGCAAAACTATCA
ACATAGGGCTGAATCTAGAGACTGAGATCAGACAGATGATTTGGTTCGAGCGTCAAGAAGACGGCACTGCATTGAGTACG
CAATAAATAAGCGAGTATAAGAGGTGTAGGACAGACACGAACATATCGCTTGGGCCACTCACTTCCGTAAACACTACAAC
CTCGTCCAAAATCAGGACAACTTCTCTAAAGAAGCTATGGACGTCGAGTTGTCCCCAAAGCGACGTTGCGTAGGTACAGC
TAGCTGCTCTAGCAGAAATAAAGCGATGATGACGCTCATGTTTCTAACTTCAGCAGCAATCGCGAGATGAGATGGAAGTG
ATTCCAGCGACACTGACCCATTTCATCTGTCCCATAGCTATGTGCGGTTCAGCAAGGCCATGCTCAAAGCAATGGCTAGG
AGACTTGACTTATGGCAGAAGATTCCCGAGATCCAGACAGAAGCGTGAAATGGCATATACGGCTCTGCCAACGGCTAGAC
AACAGGGCTAACATAGAACAGCAAAGTGGAAAAAATGGCCAAGCATGTTGCAGATGTCGTTGAGAGTGCTGCTGAAGCGA
TGGGAAGATAACCATTCTGTTTATACATGCTTACCTAGTTCCGCCAAACATCATCCTGACGCCAGGACCTAAGAAGTGGT
AGCAGCTATTAACTGGGCGCATACGGGACGGTTCGCCACGTACTAGAAGTTCTGCTAGGCGCGACGAGAAAGGCTTATCC
CAAACTCTTTAATGATGGAATAAGACGAGAGTAACTGAGGGGTCCCACCCTCTTTCTGGATAATTGACAGCAATTCCCTA
TTACTCGTAGACTCTCCAGAAATCCTTCCAGCAATGCGCTTTTCCGAAGTCGGAAAAACCCCGCAGTGTCTGCTCTGCTA
TTGGGTGGTCGGGCGTCGGGCGTCGGGCGTCGGGCAGCAAAGCTGAGGATTTCGACGATTTCGTGAGGCCTCACAAACAG
CAACAACTCGTCTTCATCCTTTTCCTGATAATTACAGAGTCAAGAACAATGTAGCCGGGCTCATCTATTAGAAAAGCTAC
GAAGACGTCCTTCAAGGCATCTTCCAAGAAGTTTTTCAAGAAATTGTTGGGACGCGAAAAGAAGGACATCGCCAGCAATT
TCCCCTCGCAAGGCGAAGTTGTATTTCATCCCCCAGCAGCAAAAGAAGAATCCAACATCGAAGCAGCGTCAGAAGAGCCC
TTTGCCTCCACCCTCTCAAATACCCCATCAGTTCAAGCAAATATTGTCAGTTCGTCTTCCCAAAATGCCGTGCCACAAAC
CGACGACATTCCCTCCACCCCAGAAGCAGCGACAGAGGCGCTCACGGTGTCTCCCCACCCCATCTCGAACACCTCCCTAA
TTGTAGCGGACAATGCTGCAAACCCGGTTTCGGAAAATGTCGTGCTGTCTGCGCCACAAACCGACGATATTGCCTCCACC
CCGCCTCCCACTACCGCCGAAGCCTCTCCCAGCGACGAACTATGGACAAGAGCGTTTGGGCTGTTTCGAGAGAAGGAGCC
CGAGCTTGCCAGGGATTACATGACGCACTTAGCAACCCTGCACAACTCGGTGGACAGTGTAGATCTGTCGGCATCTCGGT
CGGTCAAAGATCTCGTAGACCGACTGCTCGAAAAACGAGAGGAGAAGCTATGGAAGGTTTCGATCTTGGGAAAAAGTGTG
AAGATCCGGGAACAGACCGAGAAGCTGGTCAGGCTTCTCGTTTTTTTTGATCCCGTGGTAAAGGAAGCCGTCAGCTCCCA
GCCATACGCCGCTCTGGCATGGTCTGGCGTCTCGCTGATTTTGCCTGTAAGCACACGACTGTCTTCTGATGCCTGTGCAC
GTACTTACTCCAGCAGCTGCTTACGAGCGGAACGACGCAAAACGAAGCCATGCTAAAGGGTTTCGACACGATTGGCAACG
AACAGCTCTACTGGAATATCTGCGAAAAAACATACCTCGAGTCCGCAGAGCACGAAATCTACAAACCGCTGGTCGAGCCG
CTCGCCCAGCTTTATTCCGACATGATAGCATTCCAGGCCCTTGCCATATGCCATTATTCCAAGGCCCAGCTCTCTCGCGC
CTGGGAGAACATCGCGGGCAGCAACGATTGGGACGTCAGAGCAAACAAGATTGAAAAGCAAAGCACGAATATCCAACGCA
ATATCTTGAATCTGGACAAGCAAGAGATTCGAATTCTATGGAATACGCAGCTGCAAGGGATACAGGAGTCGCAGTTTGCA
CTTAACGACGTACGCCAAATTCTCAGTGAAAACAACAGACTAAATCAGAAACGCTATGATGACGAAAAGGAAAGAGAACT
CCTCAAAGAGCTTGCATCAGCCTACGAGAGTTACAAGAACTTCAACAAGCAAAGAGTGGAAGGCACATGTGAATGGTTCT
TCAACGACAACAGATTCCGCACATGGCGAGACTCTAAGATGTCGAGCCTGCTCTGGGTTTCTGCTGGTCCAGGCTGTGGG
AAATCTGTCCTATCCCGAGCTTTGGTTGACGAACACCGACTTTCCACCAATGCTGCTACATCGACTGTCTGCCACTTCTT
CTTCAAGGACGGAGACGCTCGTCGCTTACGCAGCACTGCCGCTTTGTGCGCCGTGCTCCATCAGCTCTTCACCCAAGACC
ATACTGGAAGCCTGATAAAACATGCGCTGCCTAGCTACAATGAGGGCATGGCTTTAAGAAACAACTTTCCGGGGTTGTGG
AAAATCCTCATAAACTGTGCTAATTCTCCAGAAGCGGGACAAATCATTTGTGTCCTAGATGCCCTGGACGAGTGCGAAAT
ACAAAGCAGAAACGAACTAATTGGAGAGCTGAAAAGGTTCTACTGTGAACAAAGAGAACTGGCGAAATCTTCAACGCTGA
TGTTTCTGATCACAAGTCGTCCTTACGCTGATTTGGAGTTTGCATTTCTTAAATTTAACACAACGACTTACTTACGTTTT
GATGGCGATGAGAAATCAGCCGACATTGGAAAGGAAATCAGCCTGGTCATTGACGAGCGCGTGAACACAGTAGCAGCAAG
CTTTTCTGAAAAGCACCGTCTCGAACTTGCGGACCACCTCAAGAGCATGGAAAACCGCACATACCTCTGGCTTCATCTTG
TGTTTAGCATAATCGAAGGAAATTTTTCCTACTCGAGGCCGCTAGACATCAAAAAACTCCTCTCTCAGATCCCACCAGAG
GTGTCTGGAGCATATGAACAGATCTTGGATAAGAGTTCGAACAAAGATTTGACCATGAAGCTTCTCCAGCTTGTCCTTGC
GGCGGAGCACCCGCTGACTCTCGACGAGGTCAACATTGCGCTGGCATTGGCTGATAGTCCTCAGGACTCGGCCGCAGAGC
TGAAGTCTGCGCTGTGGCCAAAGGGCAACTTTCAGACTACAGTCCGAAACTTCTGTGGTCTTTTCGTCAGCGTCTACGAC
TCGAAACTCTTCTTTATCCACCAGACCGCCAGAGAGTTTCTTCTCAGCTCTGAGCGAGATGGAAATTGGAAAGGCCATTT
CGCATTACCGGAGTGTCACAGCATCTTGTCTCGTGTTTGCATCGACTACTTGCTATTTCCTGATCTTGTTGAGCACCCGT
TGATTGTCGAGGACGAAGAAAACGAGAAAGAAACAAGACCATCATTCTTTGAATACGCTGCCCGGTATTGGACTTCACAC
TACAACTCGCAAGAAGACGCAAATGCGTACAAATCACGAAAGGATGCTTGCATGCTCTGTCACGTACATCCAGGACAAGA
AGAGAAAACATGGCTAAAACTATTCTATATTATACAACTCTCAAAGTATTCAGAATTGGCTGTAGCAAGTCACTTCGGCC
TTCGAACAGTCATTTTATATTTATTGGACGAGCAGAAGATCAACATAGAACCAATGGATACCACCAAAACGTCAGCGCTC
CAAGCAGCATCATTACAAGGCCAACTTAAGACTATACGGCTTCTAATCGACCGCGGTGCCAACGTTAACCTTCAAGGCGG
AGATTACGGTTCGGCTCTCCAAGCAGCATCGAGGAACGGCTACACGGAGATTGTACAGATACTGCTTAACAGCGGTGCCG
ACGTTAACTTGGACGGCGGAGCAGCGCTTAAAGCAGCATCGAGGAACGGCCACACGGAGATTGTACAAATACTGCTTAAC
AGCGGTGCCGACGTTAACCTTCAAGGTGGAGAATACGGTTCGGCTCTCCAAGCAGCATCGAGCTTTGGCTACAAAGAGGT
TGTACAAATACTGCTTAACAGCGGTGCCGACGTTAACCTTCAAGGCGGAGAATACGGTTCGGCTCTCCAAGCAGCATCGA
TATTTCGCCACAAAGAGGTTGTACAAATACTGCTTAACAGCGGTGCCGACGTTAACTTGGACGGCGGAGCAGCGCTTAAA
GCAGCATCGAGGAAAGGCCAGACGGAGATTGTAGAGATGCTGCATGCTAGTGCTAACAACAAGACGGAAGAACTCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62