GenePrediction:GLEAN_918 Details

Name: GLEAN_918
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_132:865883..866440 (+ strand)
Length: 558
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_132:865883..866440 (+ strand)
Length: 558
>GLEAN_918 class=GenePrediction position=GCSC_132:865883..866440 (+ strand)
ATGAAGGTCTCCGCCGTCACCATGTCTGTCCTCATAGGTCTGGTTGCCAGCCATCCCCTCATTAGCAACAGCAAGCGACA
GGCGACTGATGTGCTGTCTGTCCCATCGGGCACGCCTACCGGTCATCCTCCGGGATTTCATTCAGGTTTCCCCTCGGGTG
TCCCATCTGGGTTTCCGTCTGGGTTTCAGTCCGACTTCGTCTCTGGAGTGGCACCAACTGGTGGCTTTCCTTCAGGCGCG
CCTGGTCCGCTGCCGTCTGGTGTCTTTTCAGGCTTTCCCTCTGGCGCAGCGCCGTCTGGACCTCCTCCTTCGGGCACTCC
TACTTTCAAGGTGGTCCGCCGTGACGACACCACTTCATTCCCAGCGCCTCCGTCAGGCACCGCTCCTCCCGGCTTCCCGT
CTGGCGCCACTCCCACGGGCCCGCCGCCGTCTGGTTTCCCGTCTGGTGTCGCTCCCTTTGGCATGCCCACTGGCCACTTT
CCGTCGGGTCCTGCTCCTACTGGTCCTGCTCCTACTGGCCCTCCGGCAGCTTCCGACACAGCGGCCACTCGCATCTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62