GenePrediction:GLEAN_919 Details

Name: GLEAN_919
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_132:878143..879536 (+ strand)
Length: 1394
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_132:878143..878835 (+ strand)
Length: 693
Type: CDS
Source: GLEAN
Position: GCSC_132:878916..879536 (+ strand)
Length: 621
>GLEAN_919 class=GenePrediction position=GCSC_132:878143..879536 (+ strand)
ATGGCAAACAACAACACGCACGAAACCGGTGCACCCCCGTTGGAGGTGGCCGTTGTGGGCGGAGGCATCATTGGCGTCAT
TACAGCCATTGGTCTTCTTCGCCGCGGCATCAACGCCGTCATCTACGAACGGGCCTCTACCTGGCACGAAGTCAGCGCCG
GATTTGCCTTTACCGGTGCAGCACGCGTCTGGATGAAGCAGCTAGACCCTGCGCTAGTTGAGCTTCTCAGCAACATCAGC
CAGAAAACGGATGCTGATACGAGCAACGCCTACTGGAACGGCTACCACCCACGCACGCGGGAGGATGCCGAGGACGAGTC
CAAGTCCTTGCTCTTCCGGACGCCTGCCAACAACCTCAGTTTCTGGGGCTGTGTTCGCTCGCACTTTCTCCTCGGCATGG
CTGCTCTGCTGCCCGAGGGAACTGTCAAGTTTAGGAAGCAGCTGGCGACCTATGACGAAAACCCCAATGGAAAGGTCACT
CTCCACTTTGACGACGGCACCACTGCCGAGGCGGACATCTTGCTTGGTTGCGACGGCATCCATTCGTCCACCCGGAAAGT
CCTCTTGGGCGCAGACCATCCGGCCAGCAAGCCGGGCTTCAGCCACACGGTTGTCTACGAACCATGGTTCCCATCGACGT
GGGCATTGCCGCTCTCGGAAACAAGGTTGCCAAGTGTGCCTGCAACCATCTGGGTCCTGATGCAGACCTGTTGGTGTATC
CGGTTCGTTCCATGGGGGGGGGGGGGCAAAAGGAAAAACACTGACTCATTCAGGTCATGTCGGGCACGCTGCTGAACATT
GCCGTTTTCGCTTACGACGAACCGGAGTTTCCTTGCCCGGACAAGATGACAGTCACGGTGGATCGGTCCGAGATTGAGAA
ACTGCTCAAGGGCTGGAGTCCCCAGATCGCGGACATTTGGAAACTGTACCCGGAAAAAGTGGTCAAGTGGGGAATCTTTG
ATCTGGAGGACAACCCGCCACCCACATATGCCCGTGGCCATGTTTGTCTAGTCGGAGACGCGGCGCACGCCAGCACCCCG
TACATGGGAGTTGGCGCCTGCACTGGTGTCGAGGATGCCCTTGTGATCTGCACTCTCCTCGAGTCTGTGCAGAAAAAGGC
ACTAGCAGGACCGGCCTTGGAAGAGGCCCTGACAGCGGCCCTGCAGACTTACACAAATGCGAGGCTGGAGCGAGGCAAGT
GGGTCCACCACCAGTCCCGCCAGATGGGACAGATGTACCATTGGCGCTATGGCCCTATGGGACGCGACCCGCAGCGCATG
AAGCAGCAGCTCGAGGAGAACTGGGGCAAAGTGGTGACCTTTGACGTTTTGGCACCACTGGACCCCGAGCTGCGTGAATT
GGCCATGCGTCCGTCGGTGACTGCAGCAGTTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62