GenePrediction:GLEAN_91 Details

Name: GLEAN_91
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_179:612689..615262 (+ strand)
Length: 2574
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_179:612689..613620 (+ strand)
Length: 932
Type: CDS
Source: GLEAN
Position: GCSC_179:613675..615262 (+ strand)
Length: 1588
>GLEAN_91 class=GenePrediction position=GCSC_179:612689..615262 (+ strand)
ATGGCGTTCTCACTAGAGGAAATGTACCAGCAGGAAGTAGTGTCACTGGCGATCCCATATCACGGCGACGACGACGGCAC
GGCAGATTTCGACAAGCAGGCCAAAGGCAAGGAGAGGGCAGACGAGAAGGATGAAGCAATGAGGCCGATAATAGAGGCAG
AGGAGCAGGACACGGAAACAGACACGGATACGGACGAAGAGAAAGACAAGAGACGGCTGCCGCGACCTGGGAGTGGCTCC
GGAGACGATACCGACGCGGACTATGACGATTTGAGCTGGATGTCGGTGCCTCCACCAGCGGCACTGACAGAAGGCCTGAC
GAGCGATCTGGCCGAGGTCCTGGTTGAAATTGCACGGTCGTCGATCGAGGGTGTGCAGGCGCGGGCAGCCCAGAAGATGG
CAGAGCGGGCGGCACGCGCAGAGCAGGCGCAAATAGACAAGGCCAAGGCGGGTGTGGTGACAGCCGAAGAGGTAGCCGAA
AGAGCAGCGCAGACGCTCGTCGAAGAGAGAGGCTGGCCTCTGGCCAATCGGTCGCTAGAGCTGGACATGCTCAAGGGCAA
GGGCAAGGAGTCAGCAGAGCCAGAGACGGCCGTGTCGAGCAGTGTGGAAGCGTGGCCGCAGACGCAGACGAAGATGCAGA
CGCAGAAGCAGACACAGCCATTGCCGAGCTCCGTGTCGGAGAGGCGATCGCGCAGCCGGATGTTCGCAGCCCGACTTCTT
CGCCACGTTCACGTGCACAGCCGCAGTCAGAACAGCGCGGAGAGCAGTGCGGCGGGCGCGGCAGCAGGCGCGACAGCAGC
GGCCGAGAGGGACCTGCAATGGCTGCAGCAGAACCGCTGGCTCCTGACGGCGGAGTCGGGCATGACGGTGACGGCACCGC
TGCGGGCGGCGATGCTCCCCGGCCAGGCGACGACGGCGATGCCGGAGCCGATGTGAGTGATGACGTAATGCTGTTGTTGT
TGATGCTTACTAATCAACAAAAACAGCGAGTGCATTTCGTGTTTTGACGAGACGCCAGCACGGGAGGCGGTGCGGCGAGT
CTGTCACAGCTACTGTCTTGGATGTTTCCGGCAGCTGGTGGCGACGGCGGTGTCGAACGAGGCGCAGTTCCCGGCCAAGT
GCTGTCTGAACGAGGTGCCGTCGAGGACGATTCGGCGTCACGTGACACGAGAAGTATGGCAACGGTATGCGGCCAAAGCA
GCGGAGCTGGCGGTGCCAGTGAGCGAGCGGCTATACTGTGCGGCGGTGAACTGCGGAATGTACGTACCGGCTTCACAGCA
GAGCCGAGCAGCGCGGATCGGGCGATGCAGCGGGGGCCACGAGACGTGCACGATGTGCCGGCAAATAGCGCATGGGACGG
GCAGCAAGCGAGGGCCATGCGCGGAAGATCGAGACGGACAGCTGGCGGACGAGCTGGCAGCAGACGCGGGCTGGCGACGG
TGTCAGCAGTGCTCAGTGCTGATCGAGCATGCGGATGCGTGCCAGCACATGACGTGTCGCTGCGGCGGGCAGTTCTGCTA
CGTGTGCGGTGCAGTCTGGCGAACGTGTGAGTGCACGATGGAGGACCTGCAGGAGCTGAAGGCGCGGGCAGCAGAGCGAC
AGGCAGCACGGGCGGAGCGAGAGCGGGCAGCAGAGGCAGCAACAGCGGTGGCAGACCAAGAGCTACAGGAGCTGCGGGAG
GCGCTGCGTGCGGTCGAGGAGCTGGAGCGGGAAGAGACGCAGCGACAGGAGCGACAGCAGGCCGAGCGGACGGGACGACT
AGAGCGGCTGCGGGACCGACGTGAGGCCGTGCTGCGACGCGAGGCGCCACGACAACACGTCCAGCTGGCGGCCGACCTGC
AACGCCTGACAGGCCGACAGGAGGAGACGGCACGCAAGCGACGACGACAGCAGCGAGCAGACCACCAGCAGGCGCAAGAC
GAGGCGCGTGCGGCACAGCAGGCAGACCAGGCGAGCGAGCAGACGGCGGCAGCTGCCGAGGCCGAGCAGCTGGTCCGGAC
GGCCGAGCAGGCCTGGGCGGCCGACTACAGCGCGCGCGTGCGGCTGGAGCAGCGCGTCGAGGCTGGGTATCGCGCCGACC
TGCTGGCCGACGTCACGCTCTGGGCCGACCGGCCAGATCGGCTGTCGCGCATCGACGCCGCCGTGCGCGTGCTCATGCGC
CGCAACGACGGCCGCCTCGACGCCTATCTGCGCTGGCGCGATGGCCAGCTGGCAGCTGTGCGCTGTCGGGCCGACGAGAA
TCGTGCCATGGGCGACGAGCTGCGGACCCGTGCGCGGAGACTGGCTGCTGAGACCCAGCTGGCTCACAGGACGGCCCTGT
GCCGGGTGCACGACGCGGAACGCACGTGGGTGCGCGTGGTCGCGGCAGAACGCTGCCGCCAGCTCGAGGCCATGCTCGCG
GTCAAGCGGCGGCTCGGACTCGCTGGCTCGGCTGTCCCGGCCGACGCGGAACTGCTGCTGCTGATCGAGTTCGACGGCGC
CGGCACGCTCGACGGCGTCGACATCGAGGACTGCCTGCGGCTGCAGGAAACAGAACAGGACGCGCGAGAGAGGGTGCAGG
ACAGTTCTGCTTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62