GenePrediction:GLEAN_921 Details

Name: GLEAN_921
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_132:883606..885110 (+ strand)
Length: 1505
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_132:883606..883651 (+ strand)
Length: 46
Type: CDS
Source: GLEAN
Position: GCSC_132:883714..885110 (+ strand)
Length: 1397
>GLEAN_921 class=GenePrediction position=GCSC_132:883606..885110 (+ strand)
ATGGCAGTAGACAAGAGGCTACGCATCCTTCCGTTCAGCGTCCGCAGTCAGTCATCGGCGAAATTCTCTTTATTGCCTTG
ATCTGCTCTTCTCAACTCCTCGCGCAAGCTGGCCTCGCCATGAGCATTGTCCCACAGCACCTCATTGCCCACTCTTTTGG
CATTGAGAACAATCCGGCCAAGGTTAGCTGGTTCTCGGCCGGGTACTCACTCACGGCGGGCACCTGCATTCTGATCGCGG
GACGGCTCGGCGACGTCTTTGGCCACAAGCGCTTTTTTGTCGGCGGCTTCTTCTGGTTCTCCCTGTGGTCCCTTCTTGCC
GGAGTGGCCGTCTACAGCACGCCCGAGTTCTTTGCCTTCTGCCGCGCCATGCAGGGAATTGGCCCGGCCCTGATGCTGCC
CAACGCCATGGCCATCATTGGCCTCTGTTACAATCCCGGTCTACGACAGAACTTGATGTTCAGCCTGTTTGGTGCCACTG
CTCCCAGCGGTTTCCTTCTCGGCGCTGTCTTTAGCAGTTTGCTTTCCGAGTTCGCCTGGTGGCCCTGGTCGTATTGGATC
ATGTGCTTCGTCTGTCTGTTTCTGGCCTTGGCGAGCATCTTTATCACGCCCGGAGCGCCGCCACAGAGCAGCAGCGGCCC
GGGACGAGAAAACGCTAGCATCTGGCAACGGATTGACATCTTCGGCTCTATTGCCGGCGTGACCTCGCTGGCCCTCTTCG
ATTTTGCCTGGAACCAAGGTCCTGTGGTCGGCTGGTCGACACCTTACACGTACATCATCTTGATCATTAGCATCCTTGCC
TTTATCGTCTTTGTCCTGATCGAGAAGCGGGTGCGATATCCGCTGATCCCCTTTGGCGTGTTGAAAATCGATGCGCTCTT
CAATCTGGCCTGCGTCAGTGCCGGCTGGTCCAGCTTTGGTATCTTCGTTTACTACATGTGGAATTTCCTCGTGGTGCTCA
GAGGCCAGTCCACTCTCTATTCATCAGCTCAGTTTGTGCCGATTTCCATCTGCGGAATCCTTGCTGCCCTCACCACCGGT
CTGGCTTTGGGCCACTTTCGCGCCTCGACTGTCATGGTACTCGCCATGCTTGCCTTCCTGGCCTCTGGTATCATCTTTGC
CACTGTGCCGGTCCACCACACCTACTGGGCACAGACCTTTGTGGGCATCGTCCTTTTCCCCTGGGGCATGGACATGTCTT
TCCCTGCTGCCACCATTGTCATGAGTCGAGCGATGCCACGGGAGCACCAGGGCCTGGCCGGGTCCCTCGTCAGCACCTTT
GTCAACTACTCGATATCCATCGGGCTCGGCGTTGCAGGTACGGTGGAGGCGCAGGTGGATGACAATGGAAAGAACACCCT
GCAAGGCTACCGGGGAGCGTTTTATCTTGGTGTCGGTCTAGCCGGCCTGGGTGTGGTTGTGGCTCTAGTCTTTTGCCTTG
TGGAACGTATCCGCGGAGAAGCGCCAGACGAGGCGTCTGATGAGAGGCAAAAGGTCACGAGTTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62