GenePrediction:GLEAN_922 Details

Name: GLEAN_922
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_132:888265..896178 (+ strand)
Length: 7914
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_132:888265..888459 (+ strand)
Length: 195
Type: CDS
Source: GLEAN
Position: GCSC_132:888516..888660 (+ strand)
Length: 145
Type: CDS
Source: GLEAN
Position: GCSC_132:888716..891816 (+ strand)
Length: 3101
Type: CDS
Source: GLEAN
Position: GCSC_132:891871..893328 (+ strand)
Length: 1458
Type: CDS
Source: GLEAN
Position: GCSC_132:893395..895775 (+ strand)
Length: 2381
Type: CDS
Source: GLEAN
Position: GCSC_132:895842..896178 (+ strand)
Length: 337
>GLEAN_922 class=GenePrediction position=GCSC_132:888265..896178 (+ strand)
ATGGACACCGACAGCGAGTGGGCCAGTGAGCCTATTGCCGTCATTGGCATGGGCTGCAAATTCGCTGGGGGCTCAAGCAA
CCCCGACAAGCTGTGGGACCTCATGGCTTCTGGCCAGACGGGTTGGAGTGCGATCCCAGAAGACCGGCGGGACCTCCGTG
GAGTTTATCATCCGAATCATGAAAGAACCAACACAGTGCGTATTATGTATACAACGTTGTTCCCCTGTATATTAGTGCTA
AACCGTTCCAGTCCCATGTCAAAGGTGGTCACTTTCTTGACGAGGATGTGGCAGCTTTTGATGCGGCCTTCTTCAACTAC
TCGGCCGAGATGGCCCAAACAGTCGACCCGCAATTCCGACTGCAGCTCGAGTCTACGTATGAAGCACTTGAAAACGGTAT
GTTTTCCCTCCCACAGAGTCCTCCACATTCTTTGCCCACTAACACTGTTAGCCGGCCTGCCACTGTCAGAGGTGATGGGT
TCTCAAACGTCCGTCTTTGCGGGTGTTTTTACGCATGACTACCAGGAAGGGATCATCCGGGACGAAGACAGGCTGCCGCG
GTTCAATGTTGTGGGCACATGGGATCCCATGTCATCGAACCGCACCTCGCACTTTTTTGACTTTCGCGGAGCCAGCATGA
CGCTTGAAACGGGATGTTCGACAACGCTGGTGGCTCTGCATCAAGCAGTGCATAGTTTGCGCAGTCGGGAGGCCGGCATG
TCCGTAGTGACGGGAGCCAACGTGATGCTGAACCCGGACACATTCAAGGTGATTGGGTCGCTGGGGATGTTGTCGCCGGA
CGGTCGCTGTTTCGCTTTTGACGCGCGAGCCAATGGCTACGGCCGTGGCGAAGGTGTGGCCACCATCGTGATCAAGCGGC
TGTCAGACGCGCTGGCCAACAACGATCCCATCCGGGCCGTGATTCGCGAGACAGCCCTAAACCAAGACGGCAAGACAGAC
ACGATCACGACGCCATCGAGCACGGCCCATATCGAGCTGATGCGGGAATGCTACCTCCGGGCAGGACTGGATCCACGGGG
CACGCAATACTTTGAGGCCCATGGCACGGGAACACCGGCCGGCGACCCGATCGAAGCGGGAGCCATGGCGGCCGTTTTCA
GCCAAGGCCCAGGCCGTGAAATCGAAGAACACTATATGCGCATCGGCTCGGTCAAGACCAACATTGGCCATACCGAGGCA
GCCTCAGGTGTGGCGGCTATCGTCAAAGGTGTCCTGTGTCTGGAAAAGGGCCTCATTCCGCCTACTGTGAACTACGAGAG
GCCCAACCCGAAACTCAAGCTGGACGAGTGGCATCTCAAGGTGGTCCGAGAAGTGGAGCAGTGGCCGGAAAGTCTCGTCG
ATGGTCCACGCCGCATGTCCATCAACAACTTTGGCTACGGCGGAGCAAACGCTCATGTCATTCTGGAGAATGCGGATCCT
TGGACGCAAAGTCTGTTGGATCTGCCCGTCAACGGAAATGGACATACGAATGGTACTGGAAATGGGTATTCGACCAACGA
TGACGCCAAAGTGTTGGTCTTCAGCGCATGCGACGAGAGAGGCTGCCAGAAGATGGTGGAAAACGTCAAGGCGTATTTGG
AAAGCCGCAGTTCACTCGAATACAAGGAGGCCCAACAGCTGCTGCGCAATCTCAGCTACATATTGGGCGAACGTCGGGCG
CTCTTTTCTTGGGTGGCAGCTCACCAGATTCGTCTCGACAGAGACGGTCGAGGCAGCAGCAGCCTAAAAGCCGTCATCCA
GGCCTTGGATGCTCCCAACTTCAAACCAATCCGCCGCGCCACCGACTCTCCTCCTCGCATTGGCATGCTTTTCACCGGCC
AGGGCGCCCAGTGGCATGCGATGGGCCGTGAGCTTCTGACATCGTATCCCGTCTTCCGCCAATCGATTGACGAAGCCGAG
GCGCATCTGCGCGATCTCGGTGCGGACTGGTCGCTCTTGGAAGAGCTGCAGAGAGACAAGGCGGTGACAAAGGTGCACTC
GACCAAGATCGGCATTCCGATCTGCGTGGCACTCCAGATTGCCTTGGTGTGTCTGCTCGAATCGTGGGGCATCAAGCCGG
CTGCAGTTGCGAGCCATTCCTCGGGCGAGATCTCAGCAGCCTTTGCTGTAGGTGCTCTGACACATCGTCAGGCCATAGCC
ACAGCCTACTACCGCGCCATTCTCGTCGCAGCAGCGGACGAAAAGGAAGAAAAGGAAGACAGACAGACAAAGATACCCGG
AGCCATGGCAGCAGTCGGTCTCGGCGTGGAAGCAGTACAGCTATACATTGACCAGCTCGCCAAGACCGACGGCAAAGCTG
TGGTTGGCTGCATCAACAGTCCGGAGAGCGTGACCATCTCGGGCGACAGGGATGCGGTGCAGAAGATTGAAGACCTGTGC
AAGCAAGACGGCGTGTTCGCCCGGCGTCTCCGTGTCCAGCAGGACTACCACTCGCACCACATGGACCCTTTTGCAGAAGA
CTACCGCGAGCGTCTTCGTCTGGAAATGGCACGTGACGGGCAAAAGAAACAACGGCAGGGGATGGATCAAAAACAAAGCC
TCAAGGCCATCTTTTCGTCCGCCGTCACTGGTGGCCGCATGACCAACATCAAAGACATTGCCAGCCCTGACCATTGGGTC
GGCAGTCTGGTGCAGCCAGTCGAGTTTGTGGATGCCTTTACCGACATGGTCCTCGGTGATCTGGACGAGTCGACAGGTCG
CAGTGTCGACGTCCTGCTAGAGGTTGGCCCACACACGGCGCTCGGTGGCCCGATCCGTGAGATCCTGTCCTCGCCCGCGT
TGGACGGCCTCGAGCTCCCGTACTGGGGCAGTCTTGTTCGTGACGAGCATGCCGGCGACAGCATGCGAGCAGCTGTCACC
CATCTGTTCGAGGCCGGCCTGCCCCTGTCCATGAGCGCGATCAACTTTCCCGAGCTCGCCCACGACGAGGACGAGGACGA
GAGAGGCCTGCAGGTCTTGACAGACTTACCATCCTATCCGTGGAACCACAGCAGGCGCCACTGGCAAGAGTCGCGCATCA
ACCATGCCATCAATCGGCGCAGTCAGCCACCACACGAGCTGCTCGGAATGCGTGTTGCCGGCACAGATCCCCGGACGGCC
GTTTGGCGTCGTGTGCTGCGTGTCAGCCAGACGCCTTGGGTGTGCGACCACGTGGTCCAGGGCAGCATTCTCTTTCCCGG
CTCGGGCTATGTCTGTCTTGCCATCGAGGCAGCTCGACAGCTGCAGCAGGAGAAATCCGAGGCAGTTTCGGGTGTCCGTC
TGCGCGACGTCCACTTCCTTCTCGGCCTTGTTGTCCCAGACAACGCTGATGGCGTCGAGATCCACACCACACTGACACCG
GTCTCCGATCAAGACCAGGCTTGGCAGCGCTTTGAAGTTTCTTCGGTCACTCTGGACAATCGCTGGACTTTGCATGCTAA
GGGCTTAGTCAGAGCTGACAAAGAAGGGGCAGTCGATGATCCAGCACCACCACATCCCCTCTCTACCTACACACGCAGTC
CCGATCCCCAGGACTTGTTCGCCAACCTCTGGGTACGCAGCATCTGCCATTAACCGCTCTTCCAAAACACGACCAAAATC
GTCCAGGATGGCCGAAAGCCGCGATCCGTATGTGAAATCACCGTCCGCCACGAAACCTCGACCGATGCCGACCCTGTCGA
GGCGGCAGAGACTACGCTGCTGCATCCCATCACGCTTGACGCTGCCATTGTTTCGTTTTATTCTGCCTTGCCTAGCGTAG
GGGCTCTGCAACAAGACCCAAAGCTGCCGAAGTCGGTCAAGTCCATGTGGGTGTCCAGCAGCATCAGCCGCGAGATGGGC
AGCACGTTACGCTGTGACACGACGCTATTGCATGACGATGCCCAGAGAGGGACTGCCGACATAACCGTCTATGAAGATCA
GACGGACAACGCGGTGCTCACAATCCAGGGAATCGAGATGGCGTCGCTGGGTCGCGGAAGTGGAGCCATGGCACAGAAGA
CTTCCGACAGCCAATGGCGATGGGAGCAGGAGCTATGCAGCAAGCTTGTGTGGGGACCGGATCTGTCGCTGCGCAGACCG
CTGGCTCTGGCGCAGCTGAAGCAGCAGTTTACTCCGGTAGAGTTGGACGTGGATCGGACCAGAGACCTGGAGCGCCTTTG
TGTGTACTTTGCTCGTGAAACACTGCAGACGCTTACGCAAGATGACGTCGCCAAGCTGCAGCAGCAGCAAGATTCACACC
TTGCCCGATATTACACCTGGCTGCGCGAGTTGGCTGCCGAAAAAGGCGACAGCAGCAGCCCGACCAGCTCTGACGAGATT
CAACGGCTGGTGGCCTCCTTGCAGAGCAAAGGCATCGATGGGCAGCTGATCTGCCACCTCGGACCGCTTCTCCCTTCTAT
TCTCCGCAACGAGGTCAGTCTGGACGAGGCCGTTGGGCCCTTTTTGGCTGAGTACAACGCGAACTCGATCCGTCGGCTGC
CGGCACTACAACAGCTTTCAGCTCTCCTGCGCAAGATCATGCACAAGAACCCAAGTGCTCGTGTTCTCCAGATTCGATCT
GGATCTGGCTGGCATGTCACAGAGTCCCCGCTAGCGGCTCTGCTAGCCGAAAGGGCGGATCTTCTCACGTTTGACGAGCT
CGATATCAGCCAGAACCAGAACCTCTCCAAGACGACATTGGCCCCGGAAAGCTACGATGTCATAATCGGCTTTCAAGCAC
TGCACAACAAGGACGCAGGCAATACAACCCGGGTCCTTGCCAATGTGCGCAGTCTTTTGAAGCCGGGCGGCACACTTCTT
TTGGCAGAGACGACTGGGGTTCAGGTCGATGTCGACTTTGTCTTTGGTTTGGTCCCAGACTGGTGGCAAGAAAAAGGCAC
CGACGCCGAAATTGAAGCCGCTGTCGTCTGGGACCGCGTGCTTCGAGATGCCGGTCTAAGTGGCGCGGATCTTGTTCTTC
AGGACGTCCAGAGTGACCAGATCCACAGTCACGGCAACATCATCATGTCCACACGCGCGCCGGCACAAGAAGTCGGATTC
GCAAAGACGACCAGCTTTGTCGTGGTAAGCACTAAAAACACACCTCTCCACTCACCCAACTGTATTCGCCATCTGTCTAG
GGCCATCCAGGCTGCCGCTGGCACGGACGCTGAGATCGAGCATGCTGTTCTGGGGGAGGCCAACTTGGACACGTTCAGGA
GCAAAATTCGCGTGTTCCTTGGCGAGATGGATGAGCCCATTCTGGCTGATGTCGACGCCGTACTCATGGAAGGCCTTCGT
GCCATGGTCACCCAGTGCAGCGGTCTGCTCTGGATCACAACCGGCGCCACCGCAGAGAAAGCAGTGCCGGAACGGGCTCT
TCATCATGGTTTCCTGCGCGTGCTGCGCAACGAGTACATTGGCCGTCCATTTCTCTCTCTAGACCTCGACCCGGCCAAGC
GGTCCTCTTCAGACGAACATGACAGCATTTCCGCAACCATTGTAGAGGTGCTCGAGCAGGCTTTCGGTACTGTTACCGAA
GAGGTCAAAATTGAGGCTGGTCCTGCGGAATTGGAGTATGCTGAACGTGACGGCCTTCTCCTTGTTCCTCGGTACTACAA
AGATGGTCACTACAACGACATGGTTGTCGGCCCTCTGGTGCACAGCTGGGGTCATGGAGCCGAGAACGATGAGACAGTTT
CCAGCATTCCTCTGGAAAGCTTCTTCCAGGACCGGTCTCTGCGACTGCAAGCAGGCATCCCTGGACACCTCGACACGTTG
GCTTTTGTTGACGATGCAAAGAACAAGGATCTGCCGTCGCATCTCGTCAAAATCTCTCCCCGATCGTACGGCGTCTGTTC
ACGCGATGTCCTGGCTGCAATGGGCCAGCTCAAGTCTACATCTGCTGAAATGGGCTTTGAATGTGCTGGCATCATCATGG
ATGTCGGTAGGGAAGCCCGCGAGAATGGCTACCACGTGGGGGACCGTGTCCTAGCACTCTTGCCAGGCTCTTCTTTTGCC
AGCCAGGTCCGTGTCCCGTGGCATGGCGTTGTGCCCATCCTGACTGGAATGAACTGGGCCACCGCCGCATCAGTTCCCTT
GGCTTTCGCCATCGCCTACGCTGCTCTTGTCGATGCTGCACACCTCACCGCAAAACAGACTGTGCTCGTTCACGCTGCCG
GCGGTGCTGTCGGACAGGCTGCCATCATGATGGCCAGACACCTTGGCGTGGAAGACATTTACGCCACAGTCGGCTCACCG
GAGGAGCGAGCCCTTGTTCAGCAGCAGTACAGCCTCCCGGCCGATCACGTGATCTCCGCTCTTGACGATTCGTTTGCCGC
TTCTGTCCTGGCCGCTACTCAGGGACACGGGGTTGATGCCGTGCTCCATTCCAACCCCTACTCTCTACAGGCCAGTCTGG
ACGTCCTCGCACCCTTGGGCTGTCTAGTCGAAACCGAGAAGAATGACTCTGGTAGCAACAGCCCGGTGCCGCTGGAGTCC
TTCTCTCGCGGCATCTCCTTTGTGTCTCTGGATATGTCCACTGTCCTACGTCGTCGTGGACCCGACATCCATCGCGCTCT
TTCGGATGTGGTCCGTCTGTTTGAGAACCATGCCTTGAAGCCAGTCCATCCCGTCACTGTCTATCCTATGAGCAAAATTG
AGGAAGCTTTCCGGACCATGCAAACCGGCAAGCAGATGGGCAAGGTTGTACTCTCTGCAGAGCCCGACGAACAGGCCTTT
GTGGTTCCTCGCCCGCACGGAGTAACGCCTCGCACGAAGCTTCGTCCAGACGCCTCGTACCTCGTCGTGGGCGGCGTGGG
TGGCATCGGACGTTCCGTTGCCCACTGGCTGGTGGCCCATGGTGCAAAATACTTGCTCCTTTTGTCTCGCAGTGCCAGTG
CGCTCGACCTCGAGAAGAACAGGGAGACAAGCGGTGCGCGCTTCATTCGCGAGCTGCGCGGGCTCGGCTGCCATGTCAAA
ACCATCAGCTGCGATGTTGCCCTCGCCAGCTCGCTCACCAAAGCCATCAAGACGTGCCAAGAGGAAGACGGCTTCCCTCC
CGTCCGTGGTGTTGTCCAGGGCGCCATGCTGCTGCGTGACGCCGTCTTTGAGCAGATGACCCTCGCCGACTGGACAGATG
GCCTCCGGCCGAAGCTGTATGGCACGTGGAACTTGCATACCGAGTTTGCGCAGCCCGACGCCCTCGACTTTTTCGTCATG
CTGTCGTCTGTGTCTGGTGTCGTCGGCATCGCATCACAGACCAACTATGCGGCCGGAGGAACCTATGAAGATGCCATGGC
CAGCTGGCGACAGTCGCACGGCCTACCTGCTGTCGCTATTGATCTCGGTCCCATCTCTGACATTGGCTTCGTTTCCACCT
CGGTCAAAGTGGCAGATCGTCTGCGCAAAGACGGTGATTTCGCCATGCTCGACGAGGATATTGTCCTGCGTGCCCTCCAC
GCTGCCATCCAAAATCCGTTTGGTCCTCGCTCCCAGATCATTGCAGGCCTCAACGGCTCCCCCGGCCCGTAGTGGGATCT
CGACGGTCGCTCGCAGCTCGGTCGTGACGCGCGCTTTGCGCCTTTGCGGCCACACAGCAAGGCCGCTGCGCAACCGGTCG
ACGGCAATGAATCCCGGGCCTCACTCGCTGCGCAGCTCGCTGCGGCCAGCGACCGTGAAGAAGGGGCCAGACTTGTGGCC
GCAGCTGTGGCTGCCAAGCTCGCAGACATCTTTTTGACGCCCGTCGAGGAAATCGATCTCGGCAAGCCTCCGTCGCATTT
TGGCGTCGACTCGCTCGCGGCGATCGAGGTGCGGAACATGCTGGTTTTGCAGGCCGCGGCAGATATCTCCATCTTCAACA
TCTTGCAGACAGGAAGCATCGTCGAGCTGGCAGATTTGGTGGCGGAGAAGAGCCGTCGTTTCGCAGATGCGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62