GenePrediction:GLEAN_924 Details

Name: GLEAN_924
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_132:918485..920123 (+ strand)
Length: 1639
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_132:918485..918625 (+ strand)
Length: 141
Type: CDS
Source: GLEAN
Position: GCSC_132:918714..918751 (+ strand)
Length: 38
Type: CDS
Source: GLEAN
Position: GCSC_132:918931..918937 (+ strand)
Length: 7
Type: CDS
Source: GLEAN
Position: GCSC_132:919008..919052 (+ strand)
Length: 45
Type: CDS
Source: GLEAN
Position: GCSC_132:919129..919286 (+ strand)
Length: 158
Type: CDS
Source: GLEAN
Position: GCSC_132:919348..919404 (+ strand)
Length: 57
Type: CDS
Source: GLEAN
Position: GCSC_132:919467..919821 (+ strand)
Length: 355
Type: CDS
Source: GLEAN
Position: GCSC_132:919893..920123 (+ strand)
Length: 231
>GLEAN_924 class=GenePrediction position=GCSC_132:918485..920123 (+ strand)
ATGGCCAAGGAGAGTGCTGCTAACATGGCTCAAGAACCAACTGTAAGGGTGGTCCTGGCTGCCGACCAGCCCGATAATCC
GCATTCTCCCGGCAATGTGGCTCCAGACACGGTTCTCCAGGACCCAGTGCAGGTAGATAGCGTGAGTGCCTGTTTGGGGC
GGGTCTTTCCGCTATCAAGACCTCCTTCCGGAGATTTTATTTCATCTACTTACGGAGTACTTCTCCCAGGAACGCGTCGA
TGACGAGGGATACGATGATAGCACCTCGTGAGTCTTGGAGCGTCTGGCAAGAGTCCTAAGATAATTGGGTCTCTGACAAT
TTCTCTCAGTGATGGGGCTTCTAGCTTTGTCTCCTCCCTGAGCTCGAGTATTGTGAATTACAAGTACGTCCTTAAGCCCT
GTGATAGTATTGAGCTTTTCTGGACATCGATACTAAACTTGCATAGATATGAGGTCTGTACCTCGAATGCGCATACAGCC
GCCTGCATCATAGATCGTGCTAACATAACGGACCACGATATAGAACGGCCGCCGCTACCATGCCTTCCGTGAGGGCATCT
ACGTGGTGGTAAGCTAAGATGGCACAACTGATGACAATAACGTATACATACAATTTCGGGCCATTAACACCCAAGCTTCG
ATAGCCCAATGATGAAGCTGAGCAAGAGCGACTGGACTTAGTACACCACATTTATCGCCTTTTAATCAAGGGCGAGCTTT
TTCTGGCCCCTATCAGTGCCCACCCGCATCGTGTCCTCGACCTGGGAACAGGCACTGGCATTTGGGCCATGGACTTTGCA
GAGTTAGTTGCATTTCCACCTAGAGATGAAATTAGTATACTCATTCGTCTCTTACATCTTTAGACAACATCCTTCTGCTG
AAGTTCTCGGTACAGACCTTAGCCCCATTCAGCCTAAGTGGTATGTTAATGCAGGATGTCTCTCTTTGCAGCGAACAAAT
TCTTACTTTGAGAAAACAACAGGGCCCCTCCTAACTGCATCTTTGAGGTGGACGATTTCGAGCAAGACTGGCTGTACCAT
AAAAAGTTTGACTACATCCATGCCCGTGAGATAGCAGGCTGTGTCAGCGATCCCGACCAGCTTGTTCGCCGCGCTTTCGA
GAACCTGGTCCCTGGCGGATACTTTGAGATACAGACCGTCTACCCGCGCTTTGTCTCTGACGACGGCACGCATACTAAGG
CAGTAAACGCACAGCTCTGGATAAAGAGTGTTTGCGATGGAGCGGCCAAATTTGGAAAACCCCTAGACTTAACGAAGGAG
TGGCTAGGGGAGCTTAAGGCTGCAGGCTTCGTTGATGTCCATCAGGAGATTCGCAAGGTTCGTTCTTTCTTTACCCTCCC
GCTCCCTGAATTTTTGAAGAGCCTACCATAACACGTGTTGTCGAACAGCTCACGATTGGCGCTTGGCCAAAAGACCCAGC
CCTTAAGGAGATTGGCAGATACGGCCTTGTCCAGCAGCAGCAGGCCCTCGAAGCGTACTCGCCCGGTATTCTCTCCCGCA
TTTCTAGCTGGAAGGACGAAGAGATTCAGGTGCTCCTAGCCAAAGTGAACGAGGAGTTAAAGGATCCGGAAATCCACATT
TACCACCCCATCTACTTCATATGGGGCCGGAAGCCGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62