GenePrediction:GLEAN_925 Details

Name: GLEAN_925
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_132:921296..924019 (+ strand)
Length: 2724
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_132:921296..921494 (+ strand)
Length: 199
Type: CDS
Source: GLEAN
Position: GCSC_132:921556..922469 (+ strand)
Length: 914
Type: CDS
Source: GLEAN
Position: GCSC_132:922585..923909 (+ strand)
Length: 1325
Type: CDS
Source: GLEAN
Position: GCSC_132:923974..924019 (+ strand)
Length: 46
>GLEAN_925 class=GenePrediction position=GCSC_132:921296..924019 (+ strand)
ATGGATATTGAAAGCGAAGATATAGCAGAGCTGCGCCGCATCATCTTAGAGCAGCGTCGCGCTCTCTCAGAAGAGCGTCG
TGCTCGCTCAGAAGAGCGTCGTGCTCGCTCAGAGGAGCGTCGCGCTCTCTTGGCCGACACGAATGCAGTCGTTGAAGGAT
TACGACGGGAGAACTTGGAACTTTCTCGTGCTCAACTGGGTACTTGTTCATCTCCCGATATTTCCCTGTACTGTCTGCAG
CTAACCGTTCTGGCAACCAGACATGCCTCTCGATGATTATCTCCTCCATATTCACCGCGTCAGTTTCCAGATGTGCCGTC
TGCTTCCTATACCACAATCATCCGCCGTACCTACGACCCTATCTGAAGGCCAGAAAGCGAAGCCCGCGACTTCGGGCACA
ACAAGCATCGTGGGAAAATATTACCCGCGGAGGCTGCGTATCTGGGCCGATTTCGAACGGCTTTACCGTGCAGCCTTTGA
CCGGCTGCATGCGGCCCTCGGCAACCAGGCGTTGTTTCCCTCCATTGCGGACGTCAATTTGCTCGAGAAAGGGCTAAGAG
AGGATCTTCCTCTCGAGTTCTTAGGCTCAGACGCTTTTGTTAATGAGGGCAAGACGTCGCATTTTGTGCATGAAACACTA
GAGAAGCCGGCTCAGAGAATACTCAATGCTTACTTAAACACCACTGACACAAACAAGACTCTATATTTTGACAGCCGTAC
AGCAGGATGCCGTGTCGAAAATTCCGTCGTCATTGACGACACTGCGGCGGAGGGAGAGGGGGCACCTGTCACTTTTGTTG
CTGTTACTCGGCCACCGCCGAAAACACGTCCCGACTGTCTCGTGCTTTGTGCCGACACCAACATTGGTGACGAGACCATG
CTGTCCTTAGTATCGGCAGAACCAGAATCTATCGAGCCCGTTCCCGTCGCCGACGTCGAGTCTGGCCAGGCTCTTGTCGA
CAATTCTTTCCAAAACGTGCGCAACGTCCATCGCATCACGCTGGCGGAGCACAAGATGGTGACGCGTCTACGAGCCACGA
CTGTTTCTAGCTACGCCAATGGCCAGATGGATGAAGATTTTGTTGTTCAGCTTGCGCGCGCTGCCCGCACACGCTCGACG
GCAGAGGCACAAGAGGATGCCGCCCGAGAGTTTAGCCGCGGCAAGCCAGGACAGGTTTTTTTTTGCACGAGCCTTGACGC
AGGCTTTTCACTACATGGTATCGTCAGGCGTTGAGTTTGGATACCTGGCTTCTGGAGAGACGCTTTCGCTCTTGCACGTC
GCACCCGAGGATCCGTCAACACTGCTTTACCACACTGCGCTTTTCCCCGAGTACACTCGTCGGCAGATTGACCCCGCCGG
CCGCGTCATTGCCTCCACGCCGGATGCAACTCTGTCAGTCACGACGCCGGTTCACGAGCGAGCAGATCTGCGTGTGCTGG
CCCTGTCGATGCTATCTGCAGTTGCCTTGATGGCCTTCGAGTCCCGCCCGGAGCCTGCACGTCTGCGGAGCATCAACATT
TCGCAGCTGCCCATGTTCCCTGATGAGGCAGCACCTGAGTCGTCTATACCCTCGTTGTCATCGCGGGCAACATCACGCCA
GCCATCGACCCGACGGAGCAGCGAAGGGCCGGACCATCGCAAGCGAGGAAACGAAGACAGTCGTGATGACGACCATTACG
GGAATGATGGCGATCGGACGCGCGGACGGCTTGCAGTTCCTGCATATCGACCGCGTCAGTCATCTCCATTGAAACGCCAG
CGGTCTGAATCCGGCCATGCAGAAAGGGGCGCAGAGGCGTGGAAAGAATTAGGGAAATTCGAGAAGTTGGAAGGAATCAG
TGAATGGGAAGATCGAAAGAGACCGGAACAAGCAGATGACGACAACGAAGAGCAATTCCGCGGCCGAAAGCGCCGATGTG
TAGTTGGTCTACAATACATCTCCAAAAGAAGCGGCCTTCCCTTGGGACCGACCCTCCCGAGCACACTAGATCCATCAACT
TTTCGACCGATCCGGCCGTACTGCACGCAGGCATGTCTACGGAGTCTCGTGCAGGGTGGTGACCTCGACTACGACTGTCC
CAATGCAGTAATTCACGCCCATGCACTCCGCCGTGATGGCGTCGACCTGCGACAACGGCCAAGGAGACATGCGCTGACAG
GAGAAGAGCTATGTGATTTGGTTCGGCTGCAGGTCCTAAGCAACTCAGAGCAGGACTGTGCTTGCCTCATCGACGACGGC
TTCTCTGGCGCCATTGGATCCTTGTTCAAGATCACTGTGACGGGGTACGGATATACATTCGTGGGCAAAGGCGTTCAAAA
GTTCCACAGTCGCCGTCTGGGTCGTGAGGTCGACATTTACGACGGCCTAGCAGCCCAGCAGGGTGTCTGCATCCCCGTCT
GTCTCGGCCTGGTCCAGCTCTTGTTGCCGTACCCCATGGCAAACTGCACGCTAGTGACTCATCTGCTTCTCATGTCGTAT
GCTGGGCCGCCGCTGTACCGTGTGATTCGTGTGCACGGCGTCGATGTGGAGCGCGAGACAGAACGCACAATGGCCGAATT
GGAGTCTCTTGGACTTGTGGACAATGACGACGAGAGCAACGGCAACCTAACATGGTGTCGCGAGACGATGCGTGTCATGA
AGATCGACTTTGATCATGCACATATGCGGCCAAAAAAGCCTAAGCAACCCGAAGAGCCGGACGCTGGCCACGGCGGCAAT
CTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62