GenePrediction:GLEAN_926 Details

Name: GLEAN_926
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_132:927773..928264 (+ strand)
Length: 492
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_132:927773..928264 (+ strand)
Length: 492
>GLEAN_926 class=GenePrediction position=GCSC_132:927773..928264 (+ strand)
ATGGGCCCGCAAGATCGATCCGCAAACGGGGAAACCGCTGGGAGAATTGAAGCAGCTGGAGTCGCCACCCAGGCGGAGCC
CGAACCACTACAGCTGCACGTCTTCACGGAGTTTCAAGCGGAAGGGGAGCCTAAACACAGGTCTCTTCACGCTACTCGCG
CTGATTCCAATGGAACTTTGCGCGGTCAGTTGTGGCAGGTTACAGGAAATGCCGAGAAAATGCGCTTTGAAGAGGCTGAG
AGTGTCAACGCTTTCAGTTCCGACTCATTTTCTTGGCATCAAACGCTTAACTCCAACCTCGGCGACAGCGACTATGCCAA
AGTGGGCCAGGTGGCTCGGAGCGAGCCACCGCCGCAGGCCAGGAATCGCAAAGAGGTCATGGAAAATTGTCAAGGCTGGA
CGATTCGGGTGCTGGAGCGCCTTGCTTCGGAAGGCATCGTTAACGAGGACACAATTGCGGCGCTGCGAGGGCAAATGGAT
CCCATCGACTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62