GenePrediction:GLEAN_928 Details

Name: GLEAN_928
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_132:936778..937544 (+ strand)
Length: 767
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_132:936778..937290 (+ strand)
Length: 513
Type: CDS
Source: GLEAN
Position: GCSC_132:937527..937544 (+ strand)
Length: 18
>GLEAN_928 class=GenePrediction position=GCSC_132:936778..937544 (+ strand)
ATGGAGTCCGCTACTACGAGCACGGCGGCAGTTTGCACAATCTACACTCTTACATGGGCGAGTTCGGAACTCGTCCGGAT
CACAACGTCGTTGACTGATACCATCAGGCGTATGGTGCCAGCTACTTGCAACACCGTAGATCTCTTATTCAATATCATCG
AGGTCCACTTCTTGATGGAAGAACTTCGCTTAAAGGCTTTTAAGCTTGCCCGTCTTGCCTGTGAACTCGCCAAGGCTGCT
ACGGTCATCACCAACGCCGATCGAGATTACAGCGAAGCCGTCTCAAACTCCGAGGAAGTCTTTCACCCTTTTTCACGCCT
GCCTACTGAGCTGCGACTTCTTATCTGGACGATGGCCGCCCAACCACCATCCTTTGCCATAGCTTACTTCATGTCCTTCG
AGGCTACACTGGCCGGCCGAGAACCTGCGGCTCGCTTTATGGACAACAGGGCATTGTGGACTACCTGCTGGGAATCCCGT
CATACTATCAAACGTGTCTACGAGAAGAACAGAGTAAGCTCTTTTGCTGGCAGTAGCGTGAGTGAGATGCGGTATTTCCT
ACTTGCCACCTTCAACCGGATGGCCGAGGATTTCAAACAGCAATGTCGCCAGTTCGCTGCATGCTTCCGAGCTAATATTG
AGAGGGTGGATTTTTTGATAGGCGAGGATGATGATGACATGATTAAATTTAGACATGGGTGGGTTTGGAGTCTAGCTGAT
AGCTTCGAGCTTTTTTACTCCTTTAACAGAATCTGCACAAAGCTTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62