GenePrediction:GLEAN_929 Details

Name: GLEAN_929
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_132:944119..948430 (+ strand)
Length: 4312
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_132:944119..945413 (+ strand)
Length: 1295
Type: CDS
Source: GLEAN
Position: GCSC_132:945669..946164 (+ strand)
Length: 496
Type: CDS
Source: GLEAN
Position: GCSC_132:946483..947765 (+ strand)
Length: 1283
Type: CDS
Source: GLEAN
Position: GCSC_132:947844..948114 (+ strand)
Length: 271
Type: CDS
Source: GLEAN
Position: GCSC_132:948182..948430 (+ strand)
Length: 249
>GLEAN_929 class=GenePrediction position=GCSC_132:944119..948430 (+ strand)
ATGGCAGGCAGCGAGAAAGACGGAGACGCGGGCGAGCGGATGCCGTTGCCGGTGCTTCATGTAGAACTACCTCCAGAGTC
GGGCCAGCCGCTGCTGCCGGGGCCGGTGGCACGGTCGATCACGCTGGGGACGGAAACGATCCGGGGAGCAATTTGGACGG
CTCGAACGGTTGGCCGGGTGCCTTTCTATGCGGCACGATTCACGACGACAGCGAGCATCGAGCTGGGACGACAGGCGTTT
GACGCGGTGCTGCGAGGAGCAGGGGCGGGGAGAGCGGAAGGGACAGGCACAGACACAGGCACAGGATCACCAGACGGGGT
GGCGACAGCGGCAGCAGCAACGTTTGACGCGGCCCATCGGGGCTTTCACTACCTGCAGCTCTTCACGTCAGCCGGGTTTG
CGCTGGCGGGCGGCAGCGCGGCGACGCTGCTGGACCTGTCGGAGGTGATGCTGGTGCTGGTGGACGGGACGCTGGGGTCG
ACGGAGTCGTCGCGTGCGCTGCGCAGCATCTTGGAGTTTCTGTCGCGCGAGTTCCAGAACCCGGCGACAGGGCGACCGGG
TGAGAAGGTGGGGATGCGCGACCTGCTGTGGGGTGCGTGTGCGCTGGTGTACCTGCAGGCAGCCTGCCGGCGAGTGGACG
AGGAGGAGCGGGCGCGGCGGGGCGTCGAGGTGGTGGTGTGGGACGTGGTCGTGCTTGACGGCCGACGGGTGGACGTGCAC
GAGAGCAGCCTGTATGGCAGTCACCAGGGGGCATACCGGCGGTGGGAGGGGGAAGCAGACACGGTGCCTGTCAAGGTAGA
CGACCCTGAGACGGTCATCCGGCGACAGATTGCAGCAGCCGTGGCGGCCGATGCGGAGGTGGTGGTGACGACCAGCACGT
CCAAGATCATCACGGTCGATATCACGGGCAGCCAGCCGCTGTCGCCGATGGCATTGCCTCCGGGTGTAGAGCTCGTGGAG
CTGAGCCCGTTGCAGCCAGTTTCGGCCGGGATAGCCGAGACGACCGGGCTGGCCAGCACAGCCTTCCGAGTCGTGTATCG
AGTCAACACAAACGACACGCAGACAACGGCAATCCGGCCAGGGCTAGAGGGCGTGGAGAAAGCAGACAATGCCGGTGGCG
AGGGTGATGGCCGGGTCGAGCAGGCAGACGACGACGAAACGGAGATTGGCGATATGGTCACGCCCATCGTCACCGTCCAT
GTGCCCACACCACAGCGGTCAGCGTCGCCGGAGCCACCACCGGTGCCGCCAAAGCCAGCAGCAGCAGTCCGGCCGGCAGT
CAAGTCGCCGCTGCGGTCGGTGTCGACAACCCATTCTCTCCGGACGCCGCCAGTGCCGCAGCCCAGGACGTCGTCCAAGG
CTCACACGACGGCATCGCAGTCGCGGGCCAACCAGAAGAAGGCACGACAGCCGATATCTTCGCCACGGCAGCAGGAGCAG
CAGAAGCAGCCGAAGAAGCAAGAGCAGCAGAAGCAGCAGCAGCAGAAACAACAGCAGCAACAGCAACAGCATAAAAAAGA
CCAACATCACCAAGCACGGACGGCCAGTAGGCCAGACACGCCCATAGACAGGTCAACGGGCAACAAGAGCAGCAGCAGCA
GCAGCAGTGGGTTCCGATCTGTGCTGAAGAAGCCGGCGATTGCGAATTTGCTGCACAAGGAGGCGCCTCTGGAAAGCACT
GGTAGTCACAGCGTCCTGGGCCATTTCGGGAGCCCAGGCAGTTTTGGAAGTCCAGGCAACCACAACAATCAGGGCAACAG
CCCTGCATTTCGAAACAGCAGCGGGCGGATCCTGACGGTGGTGCAGCAGGCAGGGCCGAAGAGGCCAAGCCGAGGCGAGT
CGAAGCCGACACCGCTGACGGCACGGGCGCTCAACCGACACGAGCAGCCGGGGGGCGATGCTTTGGGCGAGAGCAGCGGA
CGCGGCAGTCCGTCGTTTACGTACGCGGCCTACCACCACCAGCACCACCGGAAACAGCGCAGCCTGGTGGCAGACGACGT
GGAGTCGCTGGCGTCTTCGCTGGCCGAAAGCGTGCCGATGCACACGGTGGACCCGATCGCGACGGCGTCTGCGTTTCTGC
GGCCAGGAGGAACGGCAACGACAGCAACGACGACGACAGCAGCAGCAGCCAGCACCGATGTCGGACTGGTCAGCGGCAAC
ACACCAACCAGCAATCATCGGCGTCGCCGGTCCTACAACAACCGCAGCAGCATCTACACGCTGCATACCAACGACTCGCA
GACATCGCTGGTGGTGTCGACATACGGCGGAGGAGCAGCGAGCAGCAGCGATGTTCTCCTCCACAACAACAACAACAGCA
GCAACAGCAGCAACAGCAGCGACGCGTTTATCAGAGAAATCCAGCGCACCGGACGGGTGGCCGGCATGTTTCCGGCAGCA
CCGCTGCTACACAGCCTGCGGCACTACATGCGCTTCTCATCGGCCGCATACGGCCAGGACTTTCTGCGGGTGTTGGGAAT
GGGCTACCCGACAGCGACAGCAGCTGCGGCAGCGGCCACGACAACAGCCACAGCGACGGCAGCATCGACACCACAGCACC
GCGACGTGGCGGCCTATGCGCACCACACGGGCTTACGACCCGAGGACATCGTCCTGGCCTCCTTCATTGACGGGACAGGC
GGAACAGCGAGGGCCAAGACACAGAAGCGACAGCCACAGCTACCACCGCTGGTACACTACGTGGCGCTGGACCATGGACA
ACATGCAGTAGTGCTGGCCTGTCGCGGCACGCTCGGGTTCGAGGACGTGCTGGCCGACATGGCGTTTGCATACGACGATC
TCGTCTGGCGCGGCCGCACATATCAGGTGCATCAAGGCGTGCACGCGGCTGCGCGACGGCTGCTCTACGGCGGTGACGGT
CGCGTGTTGGCGACGCTGCGAGCGGCCCTGCTGCGATACCCCGACTATGGCCTGGTGCTGTGCGGCCACTCGCTCGGAGG
GGCTGTGACGGCACTGTTGGGCGTGATGCTGTCAGAGGGGGGAGACGAGGGGGTGCAGTTTGTCACAGCGAGCTCGCCGA
AATTGTTGGGGACGACCACAACGACCAGCTCCACGCCATCACTGCCTCCGGGCCGGCCGGTTCACGTGTTCGCCTACGGA
GCCCCCGGCACCATGTCTGAGGGTCTGCGACGGGCAACACGAGGACTGATCACGAGCGTGGTCCAGGGCGACGATGTGGT
GCCGTACCTGTCGCTGGGTGTGCTGCACGACCTGCAGGCGGTGGCGCTGGCCTTTAAGACAGACGACAGCCGTGCGTCGG
CCGAGCTGTGGAGCCGGCTGTGGGAGGGGTTGCGGCGAAGTCTGGGGGTAGGAGGAGGAGCTGCCGGTGGAGCAGAAGGG
ACAGCTCCCCCCAATCTTCCGGACGACTGGGCACACGCGGCCCTCAAGACGCTGCGGGCCAGCATGCTGAGCGCGAAGCT
GGTGCCACCCGGCGAGGTGTTGCTGGTCTCGTCGCAGCAAGTGCTGCAGCGGAGTGGTGGTGGTGGTGGCGGCATGGATC
CGCTGACAGTGTCGCCGGCACGGAGATTGATGCTGCGACACGTGCGCGACGTCGAGGCACGTTTCCACGAGGTGCGCTTC
GGCCTGGCAGCCCTGGTCGACCATAGTCCGGGGCGGTACGAGGCCGCGTTAGACCAGCTGGCAACAAGAGTGCAATTGTG
AGGGATGATGGAAGGCCTGATTCACCTTGGACTCGTCACGTGCAGTATGACGTCAGCTTCCCCGCCTGTGCTGATTGGAG
GGAAAATCACCGACCCCAGGAACGGCGCCGAGTTGCGGCCCGGCTTCGGTGGGTACTGGGCCGAGTTAGCCTGCTGCAAG
AGTGACATGTTCTCGCATCCTTTCATCAGCACTTTGCCCTGGACTTTGTTCCTGCACATCACACAGCACCTTCACTCCAC
GCCAGCAAGGTCAAGCACGATGGCCTCTGAATCGGTAACGGCCTCAGTCCTGACGCAAGTCCACACTCTCAGCCAGGTAC
GGAATATGTTCTCTGAGCGACAGACGGCAGCTTGACGTGCTGACACTTCCTCTCCTCTGACAGATCCAGCGCCCGCTGCC
TGCTCCGGGCCCGGGGGAGATCCAGGTGCGCATCAAGGCCGTCGGCCTCTGCGGCTCCGACCTGCACTACTATCATCAGC
TGCGCAATGGCGACGCTGTCGTGCGCGAGCCCATGACCTTGGGCCATGAAGCTGCCGGCATCGTCGAGGTTGTCGGACCT
GTCGCGGCTGGCGCTGCTGTCGATTCTGACCACGTTTTCCACGTCGGCGACCGCGTCGGCGTCTCGAGCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62