GenePrediction:GLEAN_92 Details

Name: GLEAN_92
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_179:620335..621932 (+ strand)
Length: 1598
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_179:620335..621612 (+ strand)
Length: 1278
Type: CDS
Source: GLEAN
Position: GCSC_179:621681..621932 (+ strand)
Length: 252
>GLEAN_92 class=GenePrediction position=GCSC_179:620335..621932 (+ strand)
ATGCCCTTCGCCTTTGTCCTGCCGACCACGTCGGCCTTCTCGTTGGACGATGCCTACGCCTGTCCGACGCACCCGTCGCT
GCTGCGCGGCGCCACCACCTACCGCGGCGTCGTCCGCGACACCCTCAAGAAGCACAAGCGCCTGCCGCCCGAGGCCCAGG
CCGCGAGCCTGGCCCTGGTCGTGTCGAGCCTGGAGGACTACCTGCCCTATCTGATGGTGATGGGATGCCGCGACAAGGCC
AGCCAGGCAGCAAACCAATTCGGCGTCCAAGTCGTCCCCGCATCCTCCCCGGCCTCGTCTGTCTGCGTCTCCTCCTGGCG
ACCGACCATGGCCGGCTCGCGCGTCCCCGGCCGCCAGCCGGCCCGCGTGGCCGTCCGCTCGCTCGACCACGAGACCGCCT
TCGTGCTCGCTACTCTCGGCCATGCCCGCACGCTGCAGGCTCGTGCTGCTCTGCAGCCGCTGCAGGCGGCCACGTCGGTC
GCACCGGCTGGACCACAACAGCGCGCGTCGGCCGTCGCTGCTGCCACGCGCCATCTCCTGGACGCTGCCTCCGTGCTTAC
GTACGCAGCCACACAGATGGAGATGCCGGCATGTTCTACCTCGCCCATCCCCTACGACATACACCCTGCCCTCCTCCGGG
CCCATGCCGGCCTCGCCCTCGCCGAGGCCACCCTCCTGGCCGTCCTCAAGGATGACCCCTACCCGGCCGTCATGGCACAG
CGTCGCAACGAGCTCGACCGCGAGTGGATGTACAAGGCCCCCGACATTCCGCGCGTTCGCGCTCACCTCTTTGCTCGTCT
CTGTCTGGCTGCTGCCGAACACGTCGGCCGCGCCTTGGCCTCGGCCTCGTCCGCCTTTGCTTCTTCTTCGTCTTCGTCCT
CGTCCTCATCCTCGTCATCATCTTCCCCCTACACCCGCTACCTCGACGACCTTCGCCGGACGGCGCGCGCCAGAGCCTGT
CGCTTCTTCGCCATCGACGCTGAGCTGGCTGGCCACACCGGCACCGCCCTCGCCTGGCTGCACGCTGCCCTGCAGGAACT
CGGCGACAGCTCAGCCGGCAGCGATGCTACTACCTCCACCACTGGCTCTGTGGCCACAGCTTCCTCCTCGTCCTCCTCCC
GCAAAAACTTGCTTGCGCGCATCAAAAAAGACCGCTTCGAAAAGCACGAGGACCGCCGGCTGGCCCGTGGTGTCGGCTGG
GGCGCCGATGCCGGCCGCCTCGATGAGACCCGCGTCGTCGAGATGCTCGACGCCAAGTGGACCAAACAGAACGACACTGT
ACGTGTGTGCTTTGACCTATCTATATCTGTACTACCTTTTTGCTGACATCCCTCTTCTACCCCCAGATCAACACCCAGCT
CATCCCCCCCTATGGCCCGCTGCTGGCACAGATGCCTTCTGGCCGCGACGTCCACACCGTCAAGCCATTTGACCCGCCCG
TGCTCGATTCGGCCGTCCTCGAGGCCATGCGCGCGCCTCCAGACCCGCTCGACAGCAACGCCCTCAGCCTCGGACCTGAT
GTCGACTCCAGCAGTGACGACGACCAGTCGGCCACGGCCAGCTCGCGCGACGACCGCGCTCAACGGTCCTACTACTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62