GenePrediction:GLEAN_930 Details

Name: GLEAN_930
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_132:948499..949511 (+ strand)
Length: 1013
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_132:948499..948587 (+ strand)
Length: 89
Type: CDS
Source: GLEAN
Position: GCSC_132:948663..949146 (+ strand)
Length: 484
Type: CDS
Source: GLEAN
Position: GCSC_132:949212..949511 (+ strand)
Length: 300
>GLEAN_930 class=GenePrediction position=GCSC_132:948499..949511 (+ strand)
ATGCAGTTCGCCGCGTCTGCCCGCAAGTGTCCTCACTGCCAAGGCGCCCTGCAGAAACGCATCAACCGGCCGGCCCGGTG
GTGTTTCCGGTGAGTGGAGAGAGGAAGAGGAAGATGAAAGAAAAGGAAAAGAAAGGAATGATTACGTAATGCTGACTTGG
CCAGAATCCCAGACACGTTCAGCTACGATCTCGGTGCCCTGATCGAGCCGTTGGCCGTGGCCGTGCACGCACACCGCCGC
GGCGGGCTTGCTGACGCTGATGTCGACGTCGACCAGACACAAAACATTCTCGTGCTGGGCGCCGGCCCCGTCGGCCTATT
GGTTGCGGCCGTCTGCCGCTACGCCCATCTGCAGCGTGCCGGCCGCGACAAGGCGGCTGGCCTGCACATTGTCATGCTCG
ACCTGATCCAAGACCGCGTCGACTTTGCTGTGCAGCAAGGTTTTGCCGACGTCGGCGTCGTGTTGCCGCGCGACCTCCTC
GGCCAGACCGACGCCGACAAAGACGACGACAAGGCCGGCCTTCCACCCAAGTTCACCAACCCCAGGGCGCTCAGCGAACT
GCTCGTGGCCAAAGCCCGTGACGGTGCCCTTTACGACGTCACTTTTGAGTGCACCGGCCAGGAATCTAGCGTGCAGACGG
GCATCTTTGTAAGCATGATCTCTCTCCCGATCCCGTGACTCCGTGACCCCGTGACCCCGATCTAACAACCCAGTCTACGC
TTCCGGGCGGCCGCATCGTCATCGTCGGTATGGGCGCGTCTGCACAACGGATCCCACTAGGAACGGCCGCGGCCAAGGAG
GTCGACATCGTCGGCGTATTCCGCTACGCCAACGACTACCCCGAGGCCATCCGACTGCTACGCGAGGCCGACGCCGAGCA
GCTGGCCCATATGGAGAAGATCGTCTCCCACCGCTTTTCCGGACTCGCCAATGCTGCTGCGGCCTTTGAACGCGCCAGCA
AGCCGTACGACGAGGACGGAAAGCTGGTGCTCAAGGTGATGATTGAGCCATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62