GenePrediction:GLEAN_932 Details

Name: GLEAN_932
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_132:981997..984301 (+ strand)
Length: 2305
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_132:981997..982876 (+ strand)
Length: 880
Type: CDS
Source: GLEAN
Position: GCSC_132:982949..983781 (+ strand)
Length: 833
Type: CDS
Source: GLEAN
Position: GCSC_132:983846..984301 (+ strand)
Length: 456
>GLEAN_932 class=GenePrediction position=GCSC_132:981997..984301 (+ strand)
ATGGCCGCTGCGGCGCCGACGCAGAAGGTATGGGTGCGACGGCCTGGCGCATCGGCGACACTCGTTACCTTTAGCGAGAG
GGACGTGGTAGATGATGTGCGAGAAACGCTGCTACACAAATACGGTAACTCCCTGGGACGCGTATACGATGCCCCCGACA
TCACGTTGCGGTTGATTCCCCGAGCGGACAATCAGACGGAACGCACATTAGGGCCAGATGAGCCGATGGCAGAGGTGCTG
GAAAATACGTATGCAGGCGGTCAGACGATCGAAGAGGCGCTGATCATCGACGTGCCGCTGCGACGCATCACTCCTTCCTC
TTCTCCCCAAGCAGGGCGACCTGACGGCCTCTATGCCGTGCCTGTGGGCTATACAACCTCCCGCGATAGCTATTCCAGCG
GCTATGAGACGCGCACCGACTATTTTGGCCCGGGAGCTGTCGCAGCCTCCAATCATAGCCATGGCTACAGCCACGGCCAC
AGCCACGGCCACGGCCACAATCATGGTCACGGCTACAGCCATGGACCTTCCAGTCACATCCTCCAAACAACCTTTCAGCG
TCACGCGCATGCCCATCCGCTGAACCTGCATCTCCAGGCACCACCACCCAGTGCATCCGGGGGTGTAACCAACGGCCGCT
CGTCGCAGATGCCACAGGCTGTGGGTGGAGGCGCAAACGGCGGCAGCAATGGCGGTGGAGGCAGTCCACACCACCATCCA
CACTCCATTTCCGTCCTAGCAACTGGCCAGGTGCCGCCCATCCCGAATCTGCCATCGCCAAACGGCTCGCGGTGGCAGCA
GAAAGACCGCTCCGACCGGCCCAAGCTACACCGACAGATCTCGGCAAACGGTCATGTCGATGGGTCTGGAAGCCTTCACG
GTGTGTTTTGGCCGTCTTGCTGCTCTTTTTTCCCCTCTCCCATCCGGTGCTGACGTCTGTTTCATGTTGCAGAATACGTG
GGTCAAGGATCCTCGGCCGCCGGCGGCGCCGTCCCGGGATCGACGCTGGGTGTCAACGTGGGACAGTTGGTGGGACAGTT
GGGGTCTGGCCCCCCCAACATCTCGCTTGCAGCCCCCATTTCCGGAAGCTCTGTTTTGCTCGGCACGGGCGACGGTGGCC
CGGGTGCGATCAGCGGATCGCCAGGAACAGGCATGGCCGGCGATGTGAAGGGTAACGGCGACGGTGGCAGCTCCAACAAC
AATGTGATCAACGGCAATGCAGGCATAAGTGTCTCCATGGCATCGCCATCACCGCACAACGGCACGTCATCTCCGCGGCC
GGCATCACCACTGCGCACCAAGAGGCTCAAGAAGCCCACTCGGCAGATGGACGACGACAGCCACACAGAGTTGCGGTTGG
GCCCACTGACGGTGCCGCCTATCAATGTGTTGATTGTCGAGGACAACATCATCAATCTTAAGCTGCTCGAGGCCTTTATC
AAGCGGCTCAAGGTGCGGTGGCAGACCGCCATGAACGGCCGGGACGCCGTGCTCAAGTGGCGCACAGGCGGCTTCCATTT
GGTGCTCATGGACATCCAGCTACCCCTGATGTCGGGGCTGGAAGCCACGCGTGAGATCCGCCGCCTTGAGCGGGTCAACT
CCATCGGCGTCTTCGCGTCAACGCCGAGCGACAACATCGGCAATGGCCGCGACCCGCGCTCCGACAAGCTCGAGAACATG
TCGCTGTTCAAGAGCCCTGTCATCATTGTCGCCCTGACGGCCAGCTCGCTGCAGAGCGACCGGAACGATGCCCTGGCTGC
CGGGTGCAACGACTTTCTGACCAAGGTGCGTTGATGCTGCATCGTCTCTCTCTCTCTGTCTTTCCCCTTCTAACACCCAA
CACGTCCAGCCGGTCAACTTCGTCTGGCTCGAAAAGAAGATCATGGAGTGGGGATGCATGCAGGCCCTGATCGATTTTGA
CGGCTGGCGCAGTTGGAAGGAGCTCAAGCTGCCGTCCTTGCCGTCCCATGAAGCAGCCGATGCCAACGGGACATCCAGCG
ACTCCGGCACCAAGAAGTCTAAGAAGCACATCGGTCATGCGAAGCGCCTGTCCATGTCATCGGTCATTCACGAAACTGCC
GGTGGCGATAGCCTGAACACGATTAAAACGCTGTCGCTGGCCGACGGTACAGCCTCAGGTCTTACAGCTCGGTCGCCCCT
CTCCGCTTCGGCAGACCCCAGCGAGCGGTCGTTGGATTCAGCCGTATCGCCACAGACATCGCCCGAGACCACGCAGAACT
CAGACAGTCCAGCCGTCACTCCCACCATCGCTCCCCAATCGACCGACGTTGCCAGCGCTGCCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62