GenePrediction:GLEAN_933 Details

Name: GLEAN_933
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_132:988919..989406 (+ strand)
Length: 488
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_132:988919..988937 (+ strand)
Length: 19
Type: CDS
Source: GLEAN
Position: GCSC_132:988991..989406 (+ strand)
Length: 416
>GLEAN_933 class=GenePrediction position=GCSC_132:988919..989406 (+ strand)
ATGTCTTCCTCTCCTTGCAGTAAGAAGATCGCCAACCGGCTTTTGGCTCCTACTGTGCTAATATATTGTCAGAAGAGTCC
GCCAACCTCATCAACCAAATTTACCAGATCTATGAGCTGATCCAATCCATCATCAAAATTATTGGTGATATTCAGCTTCT
CTGTGGTGCAACGGTTGGGCGGTTTGTTATCAACGGTTTCCGTCTGTCAGTCGTCATCATCCGTTTTATGATCAACATCG
TCTTTCTATTTCTGCCCTTCTCCAGCCCTTTTGAGAAAGCGAATGTTTCCAAGAACTCTGTCAAAGATACCGCCACGAGC
GATGTTGCCAAGGATATGGCCACAGGTAACGCCAAGGGCAATACCACGCCCAACACCAGCGAAGTTGTCATTTCTCAAGA
CACCTCGAAGGACCCGAAGGAATCACTCGGCGACGCAATGCCCCTGCTTGCAACTGGCACGGACCATACGGTAAAGAAGA
AGGTGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62