GenePrediction:GLEAN_935 Details

Name: GLEAN_935
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_132:999345..1003134 (+ strand)
Length: 3790
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_132:999345..999436 (+ strand)
Length: 92
Type: CDS
Source: GLEAN
Position: GCSC_132:999906..1000253 (+ strand)
Length: 348
Type: CDS
Source: GLEAN
Position: GCSC_132:1001359..1002146 (+ strand)
Length: 788
Type: CDS
Source: GLEAN
Position: GCSC_132:1002215..1002305 (+ strand)
Length: 91
Type: CDS
Source: GLEAN
Position: GCSC_132:1002367..1002631 (+ strand)
Length: 265
Type: CDS
Source: GLEAN
Position: GCSC_132:1002694..1003134 (+ strand)
Length: 441
>GLEAN_935 class=GenePrediction position=GCSC_132:999345..1003134 (+ strand)
ATGGACTGGTGGGATGAGGCCGAGCTGGCTGGCTCTTTGACAAAGGCTTTGACGAGAGCTGCGTTTCAGGCCCAACGTCC
TGATTGGCCGGCGTAAGCACCGTGAGAACGGTGTGGCTGGAGCTGTGTCACGCTTTTCCCTCCAGCGCTAGGCACCTGAT
ACACCCCTCCTTTGTACGAAGGGCCTCTGCAACAATTGTACCCTCCTTCGATCCTATCTCCTCTCTGCATCTCGAACGGT
CGACCGATGCGTATCCTGTCCCCCGCCAGCCAACGTGCGTGCGTCGACGAGCTGTTCTCTTGCTAGCCACCTGCCACGCG
TGACTGTTCTTCTTTGACATTGTGAACTACGAGCACGGCCCCCAAAGCTCTTTGTCCCTGGCCGCCCGAAGACAAGACGA
ATCTACAGAGCCGGCGAGAAAGCGTGCGTCGACAAGAGATCAGTCAAAGACCAGATAGGCCAAGAAGTTGAGAAGCAAGA
AGCAAGAAAGCAAGAACAGAGAGCACTCGCCATCTGCTTGGGCGCGACAGTCTGAGTGCGATAAGATCTCTCTCTTACAA
GCGTCCTCAACAAAGGCACCCCACTGTCTCTCAAGTCTCCACCGCACGCCGCCACCACCGCCACAAACACCGCGTGCCTT
TGGGCCCGCCGCTCAGCAGGGCCCAGCCCACTCGAATATCGCAGCACCACTGCTTCACGGCCGGACGGCCTCATCCTCCA
TCTTCACAACCACGGCCTCACCATGAACGGCGCACCATCCACGGCCGACGCTGCGCCAGCTGCACCAGCTGCGCCGAACA
AGGCCCAATCAACCCCGCTGGCATCGGCGAATGGCAGCGGCAGCGCCGGTGCAGGTGCCATCAAGAAGCGCAAGAAGGAT
GCGCTGAAGCCCATCATCACGACCGAAGAGTAAGTCTGACCGCCCTGCATTCTACGCGTCTCTTCAGCCCGCCTCGTGCC
TCCCTTTGTACCGTGCCCTTACTTTATCTGTGCCCGTCTCGCTGCATCTATTTGCACCCTTCTGCCGTCTGTTTCGCCCT
GTTTTCAACCGTCTCAACTCCTGCCTCCTCTTGTCTGTTTCATCTGCTCCAATCCATTCTCTCCACGCGCACACACCCCC
TGTCCATCTTCGCTCTTTGGGGCTGAGCGCATCGCCTGGCCCTCGGCAGCCCGGCGCGACGCAGGGAGAACGTGAAGAAA
GACAGCTACACGGCCTGCACAAATCACATTTCCCCGCTGCCTCTCCTCTTTTGCCCGCTGCCTTGCCCGCTGCCAACCTT
CCCTGCCCAATCCTTGGGGCGAATGCCTGCTCGCCCTCATCGCTTTTTATCCACTTGTCGCCATATTCACTCCCCAAACC
CATTCAGTTCCATCTTTACACCTTCTCATTCTGCCATTGCCGCTCTCCGCCACCTCTCTCCGCCGCTTCGCCTCCCTGCC
TTCATCTCCCTCGTCGTACTTCGCTTTTCCACCTCTTCAACGCTCTCTCTTTTACTTTTCCCTTCCCAATCACCTCAGCA
CACTTCCCCCCTCTTCTATACCCCTCCTCTGCTGTCAGCCGCATACCATGACCAACCCGCCACCACAATTCTACCCGCCT
ACTACCCAGCTTTCGTCTGTTCTCTCGCATACTCATCCCCGTGCCAACATATTGACCATCGCCGCCTATTCGATGGCCCT
TGGCCCCTCGACCTTTGCACTCTCTTCCTCCTCTGTCCCGTCCTTTCCCTCTCTCACCCCCTTCCCCTATTCTTTTTCCT
CTGAACACGCTTCTGTCTACTACCGCTCCCATGTTGCAGAGTCTCCTGCCCAGTCTTCGCGACCGAGACCCGCCCAAGCC
AAGGTTCTTTCCGCCTCTCCTTCCCTCAGGCGCTGCTTTTCTATCGCCATAAGCGATCTCAACCCCTCACCCCACTCTGT
CGCAATTTGCTTTCGGAGCTTACGCCGTTTGCATGCATACCATGTATACCGTGGCATATATCGAGGACCAGCTAACCCGT
GTCTTCAACAACAGGCCGCCTCACCACTCTAGCCTGAACCAATCTCCAGCCGCATCCTCCTCCGCCGATGATGCTGCCGA
GAACACCGCCGACGAAGAAGACTCCGAGGATTACTGCAAGGGTGGATACCACCCCGTGGAGATTGGCGAGAAGTTCCACG
ATGGCAGATACGTTGTCGTCCGCAAGCTAGGCTGGGGGCACTTTTCTACTGTCTGGCTGTCGCGCGACACTGTCACTGGG
AAGCACGTGGCCTTGAAGGTTGTCCGGTCGGCCGCACACTATACGGAAACGGCCATCGACGAGATCAAGCTTCTCAAGAA
GATTGTGCAAGCAAATCCAAGCCACCCCGGTCGGAAACACGTCATCAGCCTGCTAGACTCCTTCGAGCACAAGGGCCCAA
ATGGCACTCACGTCTGCATGGTTTTCGAAGTCCTCGGCGAGACCCTGCTAGGCCTCATCAAGAAGTGGAATCACCGTGGC
ATTCCAATGTATCTTGTCAAGCAGATCACAAAGCAGGTGCTACTCGGCCTCGACTACCTTCACCGCGAATGCGGTATCAT
CCACACCGACCTCAAGCCAGAGAATGTCCTAATCGAGATCGGCGATGTCGAGCAGATCGTCAAGAAAGTCGTAAAGACCG
ACAACTCAGACAAAAAAAACAACCGGAACGGGAGGAGGAGGAGACGAACCCTTATCACCGGAAGCCAGCCGTTGCCCTCG
CCTCTGAATGCAAACTTCGGTCACTCAACCCCCTTCTCCACGTCCAGCTCCCACTCCAATCTCGGCCAGGTCTTGCACGA
CTGTACGTTCGCTTCCACCATCTCTGCCTCTTGACGCTGTTGCCACGCATCTTACTGACTTTCTGTGCAGGGGCACAAAA
GTCCAACTCGCCGGCAGGTGCTGATAGGGACCCCAAGGATGCTCTTGCTGAAGAGGTGCAGAAAAAGAGAGAGCAGACTG
AGTAAGTCTTCGGTGTGCGGTTCGCATCTACTTCCACCTCCCCCCCTCTGACCGTTCTGTAGGGACATCCTTGCCAAGAA
AGTTTCCAATGTGACTCTGGATAAATCACCCCCTCACCATTCTACGTCTCCCTCCGACAGCGACAAGCGCAAGGTCGAGG
ACAAGGGCCTGGACACTATCAGCGTCAAAATAGCCGATCTTGGCAACGCCTGCTGGGTCAACCACCACTTCACAAACGAT
ATCCAGACCCGGCAATATCGGTCCCCGGAGGTCATTTTAGGCGCCAAATGGGGAGCCAGCACGGATGTATGGAGCATGGC
TGCTATGGTCAGTGTTTTCTTTGGGTATCTGCTTTGCATGTCTGTGAAGCTTGCTGACAGCCGCAACAGGTGTTCGAGCT
CATCACCGGTGATTACCTCTTTGACCCGCAGTCGGGAACCAAGTATGGCAAAGACGATGACCACATCGCCCAGATCATTG
AGCTGCTTGGGCCCTTTCCCAAGTCGCTCTGCTTGTCTGGGAAATGGTCGCAAGAGATTTTCAACCGCAAGGGTGACCTA
CGAAACATCCACCGCCTCCGCCACTGGGCGCTCCCAGACGTGCTTCGCGAGAAATATCATTTCCGAGACGATGAAGCGAG
ACGCATTTCCGAGTTCCTGCTTCCCCTCCTCGAGCTTGTTCCGGAGAAGCGCGCCAATGCCGGCGGCATGGCTTCGCACC
AGTGGCTAGATGACACCCCGGGCATGCAAGGAACCAAAATAGAAGGTGTTGAGGTGGGCAGCCGGGGAGAAAGTATAGAA
GGCTGGGCAACGGAGGTTCGAAAACGGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62