GenePrediction:GLEAN_936 Details

Name: GLEAN_936
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_132:1006482..1008041 (+ strand)
Length: 1560
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_132:1006482..1007129 (+ strand)
Length: 648
Type: CDS
Source: GLEAN
Position: GCSC_132:1007206..1007684 (+ strand)
Length: 479
Type: CDS
Source: GLEAN
Position: GCSC_132:1007762..1008041 (+ strand)
Length: 280
>GLEAN_936 class=GenePrediction position=GCSC_132:1006482..1008041 (+ strand)
ATGGCAGACACAGAACCGGTCCGCTCGCCGTTGAGCACGCCAGATGCTGAAGCCGGCGAGCATGGCTCCCCAGAACTTGC
ACCACCAACTTCCAACAAGGCGGCTTCAGACAGGGAAGAAGGCGAGGAGGTGGAGGGTGAGGACGACAACTCCAAGAGTA
GGCCGAAAGCCGATGACAACGATGAAGGTGGCGATGGTGACGGTAATTCGGAAGATGACCTGCTGTCGGACGTGGACGAG
GACCAGTTTGAGGACTACGACCCGGCCACGGCATACATTGAAGAGCGCCCGATCACAATCGACGAAGAAGCAGCCCGCGG
ATTAAAATCGGCCAAGCGCAAGCGATCCGCTGGAGATGGCAAGGCCCAAAAAGCCAGAGAAGCTCGCCGCGACAAAAAGC
GGCGGCCGGTTGCAGGGAAGGAAGAAGAAGAAGGAGACGTAGCACCCGGAATCACCAAAAGCGACGGGCCGAAGAGGTCG
CGCAGGCCACATGGAGGCGAGAACGTGGCCCGTAGGAAGAAGTCCCAGTCGCCAGAGGTGAACGAAGAAGACCTGTCGCC
AGAGGAGCGCCGCAAACGGGCGCTGGATCGGGCAATCAACCTCGCTATCCGCAACCCGAACAAGCGGAGACGGAAACAGG
ATGAAGAGGTATGATATGACCTGTGCAGAAAAGTTCAGTCCATGGTATAAGTGGGAGAGTCGCGTGCTGATTTGTTCTTG
CCAGGACCTCGAGCAAGCTGCCGACGAAGAGATCGCACAACTTAAGATCAGGATGGAGAAGGCGTGCATGGCCGATATCG
ACGCACGCGCCGAGGGCAAACCGGCGGTGAGCAAGCTGCAGCTGCTACCGCAGGTAATGTCCGTATTGAATCGCAACGAT
ATCCAGGAGACGGTGCTGGATCCGGAAACCAACTTTCTGCAGTCGGTCAAGTTTTTCCTCGAACCGCTGAATGACGGCTC
GCTGCCGAGCTACACCATCCAACGTGACATCTTCACGTGTCTCACAAAGTTGCCGATTGAGAAGGATGCTCTTTTGAGCA
GTGGCATCGGCAAAGTCGTGCTGTTCTACACGCGCAGCAAGCGGGCGGAACCCACGATCAAGCGCATGGCTGAGCGTCTG
GTCGGCGAGTGGAGCCGGCCGATCCTCAAAAAGACTGACGACTTCAAGAAGCGCTACGTCGAGACTCGCGACTACGACTA
TCGGTGGGCCTTCTCCTTTCTAAGCGCTCATGGTACTCTTAACACTCTGTGTATTCTAACCAGTATCGTCCTCTTCGCAG
TGCTGCCAAGATTGCCGAGCAAGGCACCCAAAGCCAATATACGCTTACAGAGCGGCCCATATCACGCTTTGAGCTGGACA
AGGAGCTGCAGCTAGCACCGCCAGTGGTGAACCCGAATCGGGCGCAGCCAGTGGGCTTGCCGCAGTCCTACACAATTGCT
CCGAAGAGCACATTCGACGGAAACAGGACCGGAGGGGAGTTCCGGCCGATTGGCGCCAGCAGCATGGAGGCGTTCCGCCG
GATGACGCAGAAGGCCAAGCAGCGGAACAAGAAGAAATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62