GenePrediction:GLEAN_938 Details

Name: GLEAN_938
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_132:1012386..1013040 (+ strand)
Length: 655
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_132:1012386..1012394 (+ strand)
Length: 9
Type: CDS
Source: GLEAN
Position: GCSC_132:1012489..1013040 (+ strand)
Length: 552
>GLEAN_938 class=GenePrediction position=GCSC_132:1012386..1013040 (+ strand)
ATGGCTCCAGTGAGTAAACAGTATCCATTCGAAAATAAAAACGAGAGGCTGCATCTGGCACAAGACGCAAAGGCTGACGT
ATGCTTGTCTTCTTCGCCTCCAGAGATTCCAGACTCTCCGACCGGCGCAAACGGCGTCTGCGCGAGAGGCCATGCGTTCG
TTTTTCTGCGATCTCTGCCAAAAGGGCTACTCTCGTATGAACGAATACGAAGCACACCTGTCTTCTTATGACCACTCGCA
CAAGCAGCGCCTCAAGGACATGAAAGCCATGGTTCGCGACCCAGCTGCAGCGGACCGAGCTCGCCGTCAGGAAGCCAAGG
CCACAGATGCCGTGATCAGTATCAAGCTGAGTGCCGATGGCGGGACAGTTGGAGGCAGCCTAGACGGCAGCGGCAGCGGT
GGTAGCAGCACTGCGCTCGGCAACAGCGGGGCAGGTTTCAAAAAGGGAGGTTTCCGAAAAGGAGGCTTTAAATCAGCATT
TGCTACCACGGGTGACCCAGCACCTGCTGCCGCCCAAGTGTCTCCAACAGCACAGCCTTTACCGACAGCAACGCTTGCTC
CAGCTCTTGCTACAGAGGGTCCTGGCAGTCTATTGGAAAGCGATACGGAAGATGAAGGCTACGAGCCATATGACCCGTGG
AAACCAACGGACTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62