GenePrediction:GLEAN_93 Details

Name: GLEAN_93
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_179:623925..626324 (+ strand)
Length: 2400
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_179:623925..624029 (+ strand)
Length: 105
Type: CDS
Source: GLEAN
Position: GCSC_179:624174..626324 (+ strand)
Length: 2151
>GLEAN_93 class=GenePrediction position=GCSC_179:623925..626324 (+ strand)
ATGGGACCAAAAATAGCAGAAAAGAAGCGGAAGGCATCGTTGGTCGTGGCGGAGACGCACGACGAGTCGGAAAACGAGGG
CAGCCTGGACAATCTGATCAACGGGGTACTGTCGGACAGCGAAGAGGATGACGAGGAGTATGAGGACGAGCTCGACAGCG
AGGACGAGGATGAGGACGAGGATGAGCTCGACAGCGACGACATCCCGTCGGAGGGCGAAGAGGGCGACGAGAGCGACGAG
CTGGCGAAGCTGACACTGTCGCAAGGGCTCCTGGGTGATGAAGGCGCCGAGGACGAAGAGAATGAAGAGGCGTCAACAGA
CCAGCCGAACTACCGAGTGACGACGGATGCCAACGGCGGAGTGCGGTACGTGTACGATGAGATCGACCCGGTGTACGACT
CGGACGACAGCGCGCAGGAGGGGGCCAACACGATCGGCAACATCCCGCTCTCGTTCTACGACTCGTACCCGCACATTGGG
TACGACATCAACGGCAAGAAGATCATGCGGCCGGCGACGGGCGAAGCTTTGGACGCGCTGCTGGACAGCATCGAGGTGCC
ACGCGACTGGACAGGGCTGACGGATCCGGCGACGGGCAAGCCGCTGAAGCTGAGCCGGGACGAGCTGGAGCTGCTGCGCC
GCGTGCAGATGAACGAGCTGCCCGAGGATGGCTACGACCCGTACCCAGACACGATCGAGTACTTTACGGGTATCGAGGAG
ACGATGCCGCTGAGTGCGGCGCCAGAGCCGAAGCGGCGGTTTGTGCCGTCCAAGCACGAGGCCGTGCGCGTGGCCAAGCT
GGTCCGGGCGATCCGTGAGGGCCGCATCCTGCCCTACAAGCCAGCGCCGACGGGTGACGAAGCGGACGCCGAGGCCGACG
AGGCCGACGAGGGGCACCGCTACGATCTCTGGCAGGACGAGCAGCCGCGCGAGCCGCACGCGATGCACCTGGTGGCGCCC
AAGCTGCCGCCGCCCGGCCACAGCGAGTCGTACAACTGTCCGGCCGAGTACGTGCCGACACGGGCCGAGCGCGAGGCCTG
GGAGGCGGCGGACCCGGAGGACCGTGAGCAGCCGTTCTTGCCGGCTCGCTACGACGCCCTGCGCAAGGTGCCCGGCTACG
GCGAGCTCGTCAAGGAGCGCTTCGAGCGCTGCCTGGACCTGTATCTGGCGCCGCGCGTGCGGCGCACCAAGCTGCACATC
GACCCCGACTCGCTGCTGCCGAAGCTGCCGCCGGCCGAGGAGCTGAAGCCGTTCCCGACCGTATGCCAGACCATCTTCCG
CGGCCACCGGGGCTGGGTCCGCTGCGTGGCCATCGACCCGACCGGCTGCTGGCTGGCCTCGGGCGGCAGCGACGGCACCG
TGCGTCTGTGGGAGCTGCTGTCCGGACGGCAGGTCTGGAGCGTGCGGCTGACCGGTGGGGGGGGAGCAGAAGGCGATGTC
GATGCCAAGACGAGCACAGACGACGAGCGCGAGCCCGTGAGCTGTCTGGCATGGCGGCCGGGCAAGAACGCGCTGGTGCT
GGCAGCGGCCGCGGGCGAGGATCTGTTCTTGATGGTGCCGACCGTGGCCGTCGACCCGGAGCTGGAGCAGGCCAGCCGAG
CGGTGGTCGATGCCGGGTTTGGTCATGCGGCCAGCCGGGCGGCCAAGAAGCCCGAGGACGCCAACAAGCAGCCGACGGCC
CGTTGGACGCGGCCGCACGACCACAGCCTCGAGGCGGCCGGCGTGCTCGTGCAGCTGCGCGTGCGGTCGCCCATCCGCAC
GGTCAGCTGGCATCGCCGCGGCGAGCACTTTTGCACGGTGTCGCCGGCGGGCGGCCGCAGTGCCGTGGCCATCCATACGC
TGTCGCGCCACCTGAGCCAGGTGCCGTTCCGTCGCCAGCGCAACATCCCGCAGGCCGCCCACTTCCACCCGTCACGGCCG
CTCTTCTTCATCGCGACCAAGCAGCGGGTGCGCGTGTACGACCTGCAGAAGATGGAGCTCGTCAAGACGGTGCAGCCGGG
CGCCCGGCTCATCTCCGACTTTGACGTCCATCCGCAGGGCAATGGCGACCACATCGTGGTCGGCTCCTACGATCGCCGCC
TCGTCTGGCACGACCTCGAAATGTCCGCCCGGCCTTTCCGCACCATGCGCTACCACGACAAGGCCGTGCGCGCCGTGCGC
TTCCATCGCGGCGGCCTGCCGCTGCTCGCCGACGCCAGCGACGACGGCACTCTGCAGATCTACTTTGGCCGCGTCTACGC
CGATCCGATGGAGGCCCCCACCATCGTGCCGCTCAAGAAGCTCGTCCGCGGCGCCCACCGCGTCGTCGATGCCGTCGGCG
CCCTCGACGTCGCCTGGCATCCCAAAGAGGCCTGGTGCGTGTCTGCCGGCGCCGATGGCACCTGTCGGCTGTGGATGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62