GenePrediction:GLEAN_943 Details

Name: GLEAN_943
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_146:25114..27635 (+ strand)
Length: 2522
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_146:25114..25720 (+ strand)
Length: 607
Type: CDS
Source: GLEAN
Position: GCSC_146:26084..27438 (+ strand)
Length: 1355
Type: CDS
Source: GLEAN
Position: GCSC_146:27528..27635 (+ strand)
Length: 108
>GLEAN_943 class=GenePrediction position=GCSC_146:25114..27635 (+ strand)
ATGGCAAGCGATGTTGATCGTATCTCTAGGCTTCGTCCGCTCCGATTAGGCAGACCCAACGACGGAGGGGACTTGGTTAT
TAGTCAACCCGTTTCTGCCTATGACACAGGCAGCCCGACCGGTAGCGACTCACATACAGTCTTCAGCAATACCGTGGCCA
CACCGCCGATTATGGATGCAGATGCCGAGCCATTTACTGATGCCGATGAGTCTCTCCAGCAGACAGTGAGGGCCATGCAC
CCCAGGATACTTAGCAATGTGGGTGTTCTTGACGCTAGCCTACCAAGCCCGCGTCTTTCGCCCACACTGTCCGCGGTTCA
CCCGCCATCAAACTCACAGGATGACGATCATGATGAACTCGAAGATGTGGCATTCTCACAGCAGTTGATTCGCCATGATT
TGCCATGGCCACATGAGTCGCAGGCCACCGAAGATGCTGATACAACTCAGCTGACGGCAGCAGAAGACGCATACACGCAG
CAGAGCCCAGTCTCCCGAGTGGCTCAAGCAAAGCCAAGTTTCCTCGAGACTCGATCCATGCTGGAGAAATTTGACACTAT
GCCGAACGAGATGAAGACGTTCATGATGTACCAGTTTCTACGAAGATGTACGAGGAAAACCCTCCACATGGTTGCGGACG
TCGTAAATCCGGCTCTCAAATGCGATTTTTTTAGGCGACTCCCAGTCGAGCTGAGTCTTCACGTTCTATCGTATTTGGGT
TATCGCGACCTTTGTCGTGCTGCCCAAGTATCGAAACACTGGCGAAATGTCATCGACACAAATGAGACTGGATGGAAGGA
AATTTTCGACCGAGATGGTTTTGAATTGTCTCTGGGAGAATTACAAAGGGCGATCGCCCAAGGATGGGGATGGCAGGACC
CAGTGGGACCAGAAGGTTGCGAAGCAGATTTGAGTCAGCGCAACCGAATGATATCAACTGACAACGAACTTATCCGGGCA
TCAAAAACAGACACACCTCACCGGGTTAGAAATTCAAAACGAAAACGGGCAATTGCCTCCTTGCCTAGCGCTGAGCGATC
AAAACGCCGAGCTAGTGCGCAGGAGGCTGCAAGAGACGAGAAGTTCCACCCTTGGCCACAGTTACACAAGTCCGAAGGAC
CAATATCGGCTGCAAGTGCTGCTGCGGCTGCTGTTCCGGATCCACAAATCGGCATTCCGAGTTTAAGGAAACTTCACCTT
TTCAAGTCACTCTATCGCCGCCATCACATGATCCGGCAAAACTGGACCAGTGGGAAAGTCAAACCCGGCCATGTTGCCTT
TACTGCACATCCCAGACATGTTATCACGTGCTTGCAATTTGACGATGACAAGATTATCACGGGTAGTGATGACACGCTCA
TCAACGTATACGATACCAAAACTGGAAAGCTGCTCAAAAAGCTAGAGGGACACGAAGGAGGCGTCTGGGCTCTTCAGTAT
GAGGGCAATATTCTCGTATCTGGCAGTACCGATCGCTCTGTTCGTGTCTGGGATATCGAGAAGGGACTCTGTACTCAGGT
TTTTTATGGACATACGTCAACAGTCCGCTGCCTTCAGATCTTGATGCCAAGCGACACCGGCAGGATTGAAGACGGTAACC
CTGTTTTGATGCCCCCAAAACCCTTGATTATCACAGGATCTCGCGACAATCAACTTCGCGTCTGGAGATTGCCCGAACCA
GGATCAAGACGATATATACAGACTGGCCCTCCTGCAAATGACTCAGAATGTCCTTATTTTATCCGAATTCTTGCGGGACA
CACCAGCTCTGTTCGGTCTATTGCGGCTCATGGCGACATTCTTGTTTCAGGCAGCTATGATAGCACTGTCCGAGTGTGGA
GGATAAGCACGGGAGAAGCCCTTCATGTCCTACATGGGCATAGCCAGCGGGTATACAGCGTCGTTCTTGACGTCAAGCGT
AACCGCTGCATTTCAGGCTCCATGGATTCATATGTCAAGATATGGGATCTAGACACTGGCTCCTGTTTACATACGCTAGA
AGGGCATTCCCTCTTGGTAGGCCTTCTGGACCTGCGCGACGAGAAACTTGTTTCGGCGGCTGCAGATAGTACTTTGCGAG
TATGGGACCCTGAGTCGGGTAGATGCAAAAGCACACTTACAGCACACACGGGCGCCATTACTTGCTTTCAGCATGACTGT
CGCAAGGTCATTTCTGGCAGTGAGAAAACTGTCAAAATGTGGGATATTCAAACCGGCGAATGCATCCAAGATCTATTGAC
AGACCTCGGTGGTGTTTGGCAGGTCAAATTTGACGAAAGACGCTGTGTGGCAGCTGTTCAACGTGATAATCTCACATATG
TCGAGGTAATTTCTTGGTCCCCGCTGCACTTTTGCTATTTCGCCTGTCAATTGCTTTACGATAATGGTAGTTTGTCTAAC
TGTGTACAATACAGATTCTCGACTTTGGTGCTGTGCGCGATGGAAAGCCTCCTGAAGAGTTGGGAAAGCGTATACTTTTG
AACGCACGAGATGTTCAGTCCCTTATCGATGAAGAGATATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62