GenePrediction:GLEAN_944 Details

Name: GLEAN_944
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_146:31685..33935 (+ strand)
Length: 2251
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_146:31685..31756 (+ strand)
Length: 72
Type: CDS
Source: GLEAN
Position: GCSC_146:31837..31893 (+ strand)
Length: 57
Type: CDS
Source: GLEAN
Position: GCSC_146:31980..33155 (+ strand)
Length: 1176
Type: CDS
Source: GLEAN
Position: GCSC_146:33693..33935 (+ strand)
Length: 243
>GLEAN_944 class=GenePrediction position=GCSC_146:31685..33935 (+ strand)
ATGTCGCTTCAAATTCCGCACCGCGAGAGGCACGTTAATGGCATTAGCGCTGTTACGAAAGCAGTTATTCTTGTAGGTTC
AGTTGTGTTGCAGCATGGTCGAAGTGCCTACTGTCATCAAAACTGGGAAAACTGCTAACAATGGTGCTGTAGGTAGGCGG
CTCTTCTCGTGGTACTCGTTTCCGCCCGCTTTCTCTAGATGTCCCCAAAGTAAGAGATTCTGCTTGTTTCCGATACACCC
ACATTGCACGCTTTCGACATAGTCTGGTTGTACTGTCCAGCTAATGTATCTACAGCCTCTATTTGATGTAGCCGGACACC
CGATTATCTGGCACTGCCTGACGGCTATCGAAAAAGTGCCTTCAATTCACGAAGTGTACCTGATCGGCTACTATGACGAG
TCGGTGTTTCGCGACTTCATCAAGGATGCTTCGACTAGTTTCCCTCACCTCTCCATCAAATATCTGCGCGAATACCAGGC
CCTCGGAACCGCTGGTGGCCTGTACCATTTCCGGGACGCCATACTCAAAGGCCGACCGGAGCGGCTCTTTGTTTTGAACT
CGGACGTTTGCTGCTCATTTCCCTTGAACGAAATGCTAAAGATGTTCGTTGAAAAGGATGCAGAGGCGGTCATTCTCGGC
ACTCGGGTTAGCGAAGACGCGGCCTCCAACTTTGGCTGCATCGTGTCCGACAACCACACGCGTCGTGTACTACACTATGT
TGAAAAACCCGAAAGCCACATTTCGAATTTGATCAACTGTGGCGTCTACCTCTTCAGCACCGACGCTATATTTCCTTCTA
TTCGCAGTGCTATCAAGCGGCGCAGAGATCGCCCTGCTCGCCTTGTGTCGTATCCGTCATCTGAGAATCTGGAGAGCAGT
TTCATTGAATACGATGATGACGAGTCTGAGACGACTGAAGTCATTCGTCTCGAACAGGACATTCTTTCAGATATGGCTGA
TAGCAAACAGTTTTTTGTCTACGAGACGAAAGACTTTTGGCGCCAAATCAAAACAGCAGGTTCTGCCGTGCCTGCTAATG
CCCTCTACCTCCAAAAGGCATGGCAGAGCGGTTCAAAGGAGCTAGCTGAGCACAGTGAGAACATTATCCCTCCTGTTTTT
ATTCACCCTACCGCACACGTTGACCCCACTGCGAAACTCGGTCCCAACGTCTCTATTGGGCCTCGTGTAACCGTGGGTGC
AGGCGCCCGCATTAAAGAGTCTGTTGTTTTGGAGGATTCCGAGATTAAGCACGATGCTTGTGTGCTGTATTCCATAATTG
GCTGGAACAGCCGTGTTGGTGCCTGGGCGCGGGTTGAGGGAACACCTACGCCCGTGACAAGCCATAGTACCAGCATCATC
AAGAACGGCGTCAAGGTTCAGTCCATCACTATACTCGGCAAAGAGTGCGGAGTTGGTGATGAGGTCCGCGTGCAAAACTG
CGTGTGTCTACCGTTCAAAGAGCTCAAGAGAGTAAGTCGCGGCCGATCCCATCTGCCTTTCGACGACACAAAGAAGCAAA
TCTTCCAATTGCTAACTTTTTCAGGATGTCACGAACGAGATCATTATGTAAACAGGGCGCTGTAACCAATGGAAATATCT
TGAGTGGCACGCAGAAAGAAGGTATCATATATGTGGGAGCGCAACTAGCGTGCTTTCTGATGGATGTCGTATCAAGCGCG
TGATCTGACCTTCAGGGTTCGCTAGACAGCCGAATAAAGTACGGAGTCCAAAGTACAAGGTGCTGTAATGCGTAATGTGT
TGTCGCATCTACTCATATCTCAGGCTCAGTTTTCGGGCACCGAGTAGATGACAAAACCATTTGTGACGTGATTGACAATA
AGACACGTACCATGCGCGACATGTGCTCGTGATGAGCTTGAAGTCCCTATTCACCTATAGAACCATGAAGAGGAGGCATC
GTGCTCAAGACAGGCGAGAAGGTTAGGAAATGGCGCGTAACTTTGTCAGTGCAGACTCCAATGCCGACTGACACACTCCT
TTCTGCAGGTCTATGGCGACGTTGTAGTCAGCTCAGACGGCGTCCGCTCTCAGGCACGACCGCGGGTGCTAGGCTACGAG
GACAAGCCAAAGAGCTCAGACTGCTGCTGGATGTTAATACACCGTGACGAGCGCAACATCGAGGAGTCCTTATCGTTTCC
CGACCGCCTTAAAGACGTATACATCGTTCTCGAGGGCTGGGTGCTTATGTTTCGGGTCATCGTGGAGAAGACGCCGGCTC
TGGTCGACTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62