GenePrediction:GLEAN_945 Details

Name: GLEAN_945
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_146:52210..54047 (+ strand)
Length: 1838
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_146:52210..52459 (+ strand)
Length: 250
Type: CDS
Source: GLEAN
Position: GCSC_146:52632..53420 (+ strand)
Length: 789
Type: CDS
Source: GLEAN
Position: GCSC_146:53506..54047 (+ strand)
Length: 542
>GLEAN_945 class=GenePrediction position=GCSC_146:52210..54047 (+ strand)
ATGGCTAGCTTCCAGCACGACGATAGCCCGCAGAGGAAGAGCGACACCAATGTTGCTATAACGCTGGACGAAATTGTGCA
CCGCGAGCGCGATTTGGGTTTCGTCGATGCTGTCAAATTGTATCCGGCCGCTGTAGTTTGGTCAATGTTCGTATCCATTG
GCGTGGTGATGCTGGCGTTTGATCCACAGCTTCTAGGCAACTTTTTTGCGATGCCGCAATTTCAAAAAGCTTTCGGCTAT
CTGTACAATGGTGAAGTTAGCTTACCCGTTTGGCGCTCTTTATTACGACTGCTTTTGGCTACATTTTTAAAGCACGGACT
GATCAAGCATTGTGTATCTCCTGGTTCAGTACATCATCAGTCAGTTGACTTCCCTATTTCTGTCGCTTACGGATTCCTTC
TCTGACGCGTTTTCCCTGGTAGGTGCTGCATGGCAAAGTGGCCTCTCGATGGGCAATCCTATCGGCCAAGTCATCGGCCC
TCTGGTTGCCGGCTATCCCATGGACAAGTTCGGTCCTAGAAGAACTTTTGGTGCTTGCGTACTGCTGACCGCAGGGCTTG
TCTTTATCCAGTTCTTCGCCCGTTCGTTGACGGCGCTCCTGGTGGGGGAACTTCTCAGCGGTCTCGTCCTCGGCTGTTAC
GTTGTCATAGCCCCAGCGTACGCCTCGGAGGTCTGTCCAATGGCCCTGCGCGGCCATCTCACTTCCTTCGTTAACCTTTG
CTTCGTCATTGGCCAGCTTCTTGCCAACGGCATCACCACCAGCACTAGCCAGCTGGATAACCACTGGGCCTACTCTATCC
CCTTTGCACTGCAGTGGTTCTGGGTGCTCATCATCCTGCCGGGCATAATCTTCATTCCCGAAAGTCCTTGGTGGCTTGTT
CGCTGCGGCCGCATGGCCGATGCCGAGTGTGCCTTGCGCCAGCTAACCTCTCTCTCGTCGTCTTCGTCTAGACGTCACAC
CAACGATGTTGACGTTGCAGCTGCCCTGGCTGCCATTGCCGAGACCGACCGTCTTGAGCAGGAGCTAGAGGCTGGTAGCA
CCTACTACGACTGCTTCCGCGGCGCTAATTTGCGTCGTACCGAGATTGCCGTCGGCGTCTACTGCGCCCAGGTCCTCAGT
GGGACTTACCTTGTCAACTACGGAACGTACTTCTTCACTCTGGCGGGCCTGCCGACCAACCGTGCCTTTGACATGGGCAT
AGGATTCCTAGGTAAGTCCTGCCAGTTGTCGTTAAATCAGCCTTCTTCTCTCCCCCAAAGTGTTTGTTATCCGTCGCTTG
AGCTGACGGCCGACAGCGGTCGGCTTTGTGTCCACCATTCTTTCTTGGTTTCTTCTTGCTCACTGGGGTCGCCGCACGAT
CTTCCTTGGTGGCTTGATTGCCCTGGCCGTGCTTATGCTGGTCATCGGAATCCTTGATTGCGTTCCTGGTCGGCCTCACG
GCGTCGCCTGGGCCGAGTCCTCTCTCATGCTGATATGGAATTTTGCCTATGACCTAACTATTGGTCCGGTGTGTTTCGTC
ATTATATCCGAGTGCTCGGCCACCCGTGTCCGTTCCAAAAGCATCTCTGTCTGTACTGCCGCCCAAGCAGTCCTGGGTAT
TGTGATGACTGTGGCCATCCCCTACATGATCAACCCAGACGAGGCTAACATGCAGGGAAAACTCGGCTTCTTCTTTGGTG
GCCTGGCCTTCCTCTGTCTGATTTGGACCTATTTTCGCGTACCTGAAACTGCCGGTCGAACCTATGAGGAGTTGGACATT
CTCTTTGATCGCCGTGTTCCAGCGTGGCAGTTCAAGGATTACCAGATCAACCGGCCTGAAGATGCCGAAGCTTTGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62