GenePrediction:GLEAN_947 Details

Name: GLEAN_947
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_146:63961..65923 (+ strand)
Length: 1963
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_146:63961..64313 (+ strand)
Length: 353
Type: CDS
Source: GLEAN
Position: GCSC_146:64370..64776 (+ strand)
Length: 407
Type: CDS
Source: GLEAN
Position: GCSC_146:64827..65923 (+ strand)
Length: 1097
>GLEAN_947 class=GenePrediction position=GCSC_146:63961..65923 (+ strand)
ATGCGGCTTTTTCTTGGGATTCTGGCTGGCTTCACATGTTTTTCCGTGCTTGCCTCTGCCACAGACTACCATGAACAGCT
TTTGCTTCAACCGCTACCTCTATCGGCGCTCTTAGCGAGCTTTAACTTCCGGTCCAATATATCTGTCTCCGAATTCGAAG
CACACAACTTTCAATTTTTTCCTCGCTCCCTGGGCCAGATTCTCCAGTTCGCGGGCACAAGGGAACTCCACCTGCGCTTC
AGCCTCGGGCGCTGGGATGCCGAAAATTGGGGCGCCCGGCCGTGGGCCGGAACCAGAGAAGGAGGCACGGGGGTCGAGCT
CTGGGCTTGGCTTGATGCCGAGACGGACGAGCAGTAAGTCGTGTGGCCGGGTCAGTCGTCAAGCTACTAACATCCATCTT
TTGTTGCAGAGCGGATACAAAGTGGCTTACGCTGACAAACGCTCTTTCCGGCCTCTTCTGCGCCTCGCTCAACTTTATCG
ACGGAACTCGGACGACGCGACCGGTCATGTCCTTTCGGCCAGAGGGTGACCATCCGGACGGAACGATTTCGAACATGCAG
CTACTATATGGTACGCTGCCGCGAGAGGTTGTCTGCACAGAGAATCTCACACCGTTTTTGAAGCTGCTGCCTTGCAAAGG
AAAAGCTGGGATTGCATCGCTGCTGGACGGGCACAAGCTGTTCGATGCATCGTGGCAAAGCATGGCCATAGATGTTCGGC
CGATATGCCTAGAGTCCGAAGGGGGCAACTGCGTGCTGCAGATTGAGCAGACCATTGACATGGTGTTGGACATCGAACGG
TCGAAGCGACCCCGAGGTAGGTTTCTGCCAAACCTGCGCAAGGCTGCTGGCTGATCTCGGTGGTAGACAATCCGATTCCT
AGGCCAGTGCCGGCAAACGAGCTGAAGTGCGACGCCTCCAAGCCATACCACCGGGATGGTACCTGCTTCCCCACCAGCTT
CGACGCCAACCAAGGCTGGTCGCTCTCACAGATCTTTGGCAAGTCGATGAAGGGCACCTGTCCCCTAGCCGATATCGACA
CGCCGCCCGTCTGCATTGCCGTTCCCGGTTCCAGGAGTGTGTTCTTGTCTGAAGGCGTATCAGAGAGCAGGAACGCCGAC
AGCCAATTACGATGCTACCACATCAAACCGGCGACTGAATTCGAAATTGCGCTTCCCGACGACGAAGATAAAATCCGACA
GGGCATAGACATCATCCTGACGCCAGAGACGCCACTGCTATATGCCGAGCGCAGCTTGACCGGACACGGGGCCGACAGAG
GCGGGGTACAAACCATTTTAACCAACCCGAGCACAAATGCAGAGGTCGACTTTGTGTACATGGAGTCGCTCCCGTGGTTC
ATGCGCATTTACCTGCACACCCTGGAGGCGCGTATTGACGGAAGCCCTCCTGGTAGCAAGGACGAAATCATCCAGGAGAT
ATTTTACCGTCCAGCCCTGGACCGGGCTCGTGGCACCCAGCTTGAGGTGAAGATGCGGGTTCCCCCCAACGCAACGGTTT
TCTTGACGTATGACTTTGAAAAGTCCATCCTGCGGTATACGGAATACCCGCCTGACGCTAATCGCGGGTTTGACGTGGCT
GCTGCGGCCATAACGATTTTGCAGCCACGGCCTAGCGGGACAGCCAGCAGGTTCGCGACGTCGAACCTCCGGACAACCAC
GATGCTGCTGAGCCTGCCAACTCCCGACTTCAGCATGCCGTACAACGTTATTATCTTTACGTCGACGGCCATTGCTCTGG
CCTTTGGTGGCATGTTCAACATTCTCGTCCGTAGGTTTGTCGCAGCTGACGAAGGTCCAAACGTCAGCCTGCAATCGCTA
CTCGCCAAGCTCGTAGGTCAGTTCAAGAAAGCGATAATGCCGAAGAGGACAGCTCCAGGGGCGGACAAGCCGGCCTCGGC
AGCCCTGGCAGCTACGGCTACGGAGTATGGCGGACAAACATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62