GenePrediction:GLEAN_948 Details

Name: GLEAN_948
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_146:95029..96051 (+ strand)
Length: 1023
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_146:95029..95124 (+ strand)
Length: 96
Type: CDS
Source: GLEAN
Position: GCSC_146:95194..96051 (+ strand)
Length: 858
>GLEAN_948 class=GenePrediction position=GCSC_146:95029..96051 (+ strand)
ATGGCGGCTCTTTCAAACAAAACACCTGATTTCACGACGAGCGACTATGTCAAGTTCTTTGGAGCGGGTGCCCTCGCCGC
GACGCTGACACATGGTGTATGAAATGGCCGAAACCCCTGCCCTTGCTTGACCCACTCTGCTCGCTTCCTAACTCAATATA
CATAGGCGGCAACACCTATCGATGTCGTCAAGACCCGCATACAAGTTGACGATGCCATGAAGGGTCTCAACATGGTCCAG
GCCGCCCGCCGCATTGCAGCTGGCGAGGGTGCAGCTGCTCTGCTGACGGGATTTGGTCCCACTGCTGTTGGCTACCTGAT
CCAGGGTGGAGGAAAGTTCTTCGGATATGAGTATTTCAAGAAGCGTTACATCGATCTCGCCGGTGGGCTTGACCATGCTA
CCAACCACCGCACGGCCATCTACCTGGGCTCCAGTGCCAGTGCAGAATTCTTCGCCGATATTGCTCTGTGTCCCCTCGAA
GCAACACGCATTCGCCTCGTGTCGCAACGTGGCTTTGCCACCGGCCTTGCCTCAGGCTTCATTCGCCTCGCTCGCGAAGA
GGGTCTACGTGGCTTCTATTCCGGCTTCGTTCCGCTACTGTTCAAGCAGGTTCCGTACGCCATCGGCCAGTTCTCTGTGC
ACGAAGCCGCCAATGAGGGCATCTATCGTGCAATGGGAGCGGAGCGCAAGGCCCGGTTAACTCATTTGCAGTCCACTGGT
GTCGAGTTGACGTCTGGTGTCATTGCCGGTGTGGCTGCAGCGGTACTGTCACATCCAGCTGATACTCTCCTTTCCGCCAT
GAACAAGGGTGCTGGCGATCCCAAACAAGGTGTTCTCAGCCGCATGTTCACTCTTGCCGGTGAATTTGGACCCAAGCGCC
TATTGCTCACTGGGCTAGGGCCGCGTGTCTTTATGACGTGCGGCCTGGTGGCGGGACAGTTTGTCATTTATGCACAATGC
AAGGCGCTGGTGGGCGCACCGCCAAGCATTGAGATTCACAAAGAAGAGAAGCTGGGAAAATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62