GenePrediction:GLEAN_94 Details

Name: GLEAN_94
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_179:642834..646158 (+ strand)
Length: 3325
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_179:642834..643222 (+ strand)
Length: 389
Type: CDS
Source: GLEAN
Position: GCSC_179:643293..643365 (+ strand)
Length: 73
Type: CDS
Source: GLEAN
Position: GCSC_179:643444..646158 (+ strand)
Length: 2715
>GLEAN_94 class=GenePrediction position=GCSC_179:642834..646158 (+ strand)
ATGCCGCCTCGAAGCACAGGCAGCCGTGCCGGGACGTCTGCAGCGACAGGTGGCCTAATTGCTGCAGCGACTGCGTCATC
GAAGCCTACGATGTCTGGTCTCGAGCAAGGCAAAGGCAGCGGCAGCGGCAGCGGCCAGGCTCCGAGCGGTGGAGGCAGCG
GGAGCCACAGCGGCTTTCGCAAGCGGAAGAACCATCGGGCGGGAAAGAAGAAGCGTCGCAAGTCGTTCAACGTGAGCGCA
GGCGACGACGTGCACGGAGACGAGGGCAACATGGCGGACGACCCGCTGAAGGACACGGCACAGATGGCATCGCGCGACGA
CTTCTACGGCATATCCGGCGGCAATCTCAGCAGTGGCAGCGTCGAGAGCGCGAACCTGCACGACCACAGGTTAGAAGACT
GGGTGAAGCGGCACGATGAGGTCCTTGTTGGCTAATCCTTACTGTGTGTCCGTTCACAGAGACCAGACACCGTTTCTGCG
TGCTCGACGGCCGTCGTTGGCCACGACGTCGACACGGCCGCGTGGGAGCACGGTGAGCGGTGCCGCAGCGGCGGCCATGG
CGGCGGTCGAGAGCGGCGACGACGACGACATGGCGGCGACGGACAACGAGGGCGCACCGCTGCTGTCGCAGTCGCAGTCG
CTGCTCGCACAGCGCAACCGACGAGAGGCCGGGTACGGGGCGATGGACACGCGCGAAAGCGGCCGTCGCAGCCGACCGCC
GAGCCAGCGAGCATCAAGCCAATCGAGCGCACGGAAGACAGCCTTTCTCAATCCCTTTGGCATGACGCCTGGCGGCGAGA
GCAGTTACAACATCAACTACCCGCCATCGATGCCGGGAAGCCCGCGGGTGCGGCCATTGGACCGGCTCGGCCACAACAAC
CTCAGCTTCGGCGACGAGATGCTGCGGGAGGAGATGGGCAACGGTGGCAGCCAGCAACAACAACAGCAGCAGCAACAACA
GCAGCAACAACGACATGGACGACAAGAGCGACAGGAATGGCATGATCACCTGATGGTGCCGGTGTCGATGTCGCGGTCGC
CGCCCATATCCCGTGGCAGCATGAACATTATGGGAGACAGAGAGAGAGATGGCCGTGGCGACTACAACAACTACGACGAC
TACGGCAACAGCACGGAGGCGCAGACGATGCAGCCTTCGCCGATGAGCCGGCGGCGCACGTCGGTGCTGGAGGCGGCGGA
GGCAGAGGCGGACGTGTGCTTCCCACAGGAGGGCCTTTCAGAGATCGCCGAGGACGAGCACGAGCAGCAAGACAGCCGGG
ACCTGTCACCGAATCGGACGCGGCCAAACCGACGTCGGCGAATCAAGTGGCCAGACCTGGCCGTCTTAGAGGAGTGGAGC
CAGTTTGAGCTGGGGCACCAGAGCCAGGCGCGGCGGGCAAAGAAGATCACGGAGCCGCAGCTGGTCAACGGTCGGCTGCG
GCCGATTCACAAGGGCTGGCACCGAGCCGAGGAGGATGCGCCGTACCGGTTCACGTACTTCAACGAGGAGTTTCAGAGCA
CGATCCACAGCCAGACGATCTCAGAGCTAGTGCAGGCGGGCGGCAGCTTCCGCGAGCTGTTTGTGCCGGAGCCACCACTA
TTATCAGATTCGGATGGCGAAGGAGACGAGGAGGAGGCAGCAGCAGGGGCGGGTGGCGACGAAGACCTCATGAGCATGGA
TGAGGGCGAGGCCGGGCCGGAGGGAAGAAGACACCGGGAGGGACGCCGAGAGGGGAAGGAACCGACAGCCGGGCTACACC
GGGATAGCTTCAGCCTGCCGTCAGATGCACAGCATCTGTTTCCGAGCCGGTCGCAGTCGATGAGCAAGGGGGGGAGTGCA
GATAGGAGGGGAGGGTATTCGCCAAGCGGACTAGCCGGCGGATTGGGATTTAGATCCGGGCCAGGACCAGGATCAGGATC
AGGATCAGGATCAAGATCAGGAACGCGGTCGCCGGCAACGCTCGCCCTGTCAGACCGACAGGACACAATGGGAACGACGA
CGGCAACGCTAATTGGCACGACGATGACGCGGACGATGAGCGAGAGAGAGCGGCTGAAGGCGGTCGAGACAGCGACATCC
AAGGCCGAGGACGCAACGGCAGCGGCAGCGACGGCAGCATCAGCAGCAGCAGCAGCCGTGGGGACGCTGACGGGAGCGTC
GTCAGCCGTGCCGGGACCAGCAACGACAACGTCGACACCGACACCAGGACGCGGCACGGACGAAGAGAAGGAGCGGACAG
CACGGTACGGCGAGCGGCCGGTGTGGTGGCTGGACGTGCTGAGTCCGACGGAAGCAGAGATGCGGGTGCTGTCGAAGACA
TTTGGCATCCACCCGTTGACGGCAGAGGACATTGTGATGCAGGAGCCACGGGAGAAGGTGGAGCTTTTCCAGCACTACTA
CTTTGTCAGCTACCGGTCGTTTGACCAGGATCCGAACAGCGAGACGTTTCTGGAGCCGGTCAACATGTATGTGGTGGTGT
TCCGGGAGGGCGTGCTTAGTTTCCACTTCAGCATGACGCCGCACCCGGCCAACGTGCGGCGGCGGATCCGCCAGCTGCGG
GACTACATGCTGCTGTCATCGGACTGGGTGTCGTACGCGATCATCGACGACATTACGGACGTGTTTGTGCCGCTGATCCA
GAACATTGAGGACGAGGTGGACGACATTGACGACGCGATCCTGCAGATGCACTCGTCCGTAGGCGAAGGCGACCAGGCGA
CCCGGACACGGGCCAGCGGGCTGACCGGGCTGAGCGGACTGAGCGGACTGCGGCCGAGCACGTCGGGGGCCAGCGAGAAG
AACGACGACCCGACGCCGGCGCAGCGAGCCGAGACGGACTCGGACATGCTGCGGCGAGTGGGAGCGTGTCGCAAGCGGGT
GATGGGGCTGTACCGGCTGCTGGGCAACAAGGCGGACGTGATCCGCGGGTTTGCCAAGCGCTGCAACGAGCACTGGGAGG
TGGCGCCGCGTTCGGAGATCGGGCTCTACCTGGGCGACATCCAGGACCACATCGTGACGATGACGTCGAATCTGAGCCAC
TACGAGAAGATCTTGTCGCGGTCGCACGGCAACTATCTGGCCCAGATCAACATCCGCATGAACGAGCGCCAGGAACAGAC
GGCCGACGTGCTCGGCAAGCTGACTGTGCTCGGCACCATCGTGCTGCCCATGAACATCATCACCGGGCTCTGGGGCATGA
ATGTCTGGGTGCCCGGCCAGGACCACGATGGTGACCTGCGCTGGTTTGCCGCCATCACGGCCGGCTTACTCTTCTTTGGC
GTCGCCTGCTACCTCATCGCGAAGCGCGTCTATCAGATTGTGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62