GenePrediction:GLEAN_951 Details

Name: GLEAN_951
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_146:108539..112362 (+ strand)
Length: 3824
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_146:108539..108928 (+ strand)
Length: 390
Type: CDS
Source: GLEAN
Position: GCSC_146:109006..109708 (+ strand)
Length: 703
Type: CDS
Source: GLEAN
Position: GCSC_146:109773..111799 (+ strand)
Length: 2027
Type: CDS
Source: GLEAN
Position: GCSC_146:111859..112362 (+ strand)
Length: 504
>GLEAN_951 class=GenePrediction position=GCSC_146:108539..112362 (+ strand)
ATGGACCCAGAATACGAGGGCGGTCCAGCCAGCGACCGCACATATGGCCATCCCCAATTACCACCGAATAATGCAGGAGA
ATATCCTATGGAGAGGCAGCATAGCAACGTGAGCCAAGGCCAGTCGTGGCAAAATAGCGGAGGCTACGGGCCTGTACCCG
GTCGTCCGCCGGTGTCTCCTTCTCAAGGCGATCGAGGTCGGAACATGGACCGGGGACGAGACCGAGAATTGGAGCCAAGA
CCAAGTAGTGATCGAAAACATTCCCAACAGGGCAGCTCAAGGACGGCAAGCGGGCTGCCACGGACCTGTAACAAATGCGG
CGAGCCGCTTACGGGGCAGTTTGTTCGTGCCCTAGATGGAACATTTCACTTGGACTGCTTTCGGTGTCAGGTGAGTCACT
ATCTGCGAGGCTCCTGTGGTGGTTAGGTCGGAGGTGGTGTTACCAGCTACTCATATATCAATCACAGGACTGCGGCCAAA
TTGTAGCGTCAAAATTCTTCCCGGCGAGCGACACAAATGATGGCCCTCAGTATCCACTCTGCGAAACAGACTACTTCCGA
CGACTTGGCTTGCTCTGCTATCACTGCGGCGGGGCACTCAGAGGGTCCTACATCACCGCCCTGGACCGGAAATATCATGT
TGACCACTTCACATGCTCGCTCTGCTCGACAGTCTTCGGGGCGCAAGACAGCTACTACGAGCACGACGGTCAAGTTTACT
GTCATTACCACTACTCGACGCAGTTTGCTCAGCGGTGTAATGGGTGCCACACTGCTATCTTGAAGCAATTTGTCGAGATC
TTTCGAAACGGCCAGAACCAACACTGGCATCCAGAATGCTATATGATACACAAATTCTGGAATGTCCGGCTAACTGCGCC
TCACGACGAAGATGGACAGCCTCCCGTAGCAGAAGTCGACGAGACAGCTAAACGCACTCTTGTGCGTGAAGAAGAGGAAA
GGATGGAAGATAAGGTGTATCGTATATGGAGCGTTCTGTCTACTTTTGAAGAATCGTCCGCTGCCTGTATATCCGACATG
TTGCTGCACGTCAGCAACGGTGCCTACGTGGACGGCGTGTTGGTGGCCAGGCGGTTTATCGGACACGTCGAAATTCTGTT
CCGCTCTGCCGACAACCTCGAAACGGCTATAACGAAGTTTGATTTAAAAAGTACGTGCAGCCCTGAGATTTTCGGTCCCC
TATGGGTACATGTCTTGCTGACTATCATGCTTAGGTTTGTCTTACGGGCGTGAAGCAAAGTTGCTCTGTAAGAAGATTGT
GGCCTTCTTCTCGCTACTTTCCAAGTCGCAAGATGCTACGACTACGAAGGTTGGCGTGACGCAGGAGCTGCTATCTCTGG
TTACCAGCCTGGCCCACTATCTCAAACTCTTGATCCGCATCTGCCTCCAAGGGGCTCTTCGCATTGAAAAGGAACGGAAC
ACGTCAGAAAGCCTTCTTGGGTTTCTCGACGATGTCAGCGCCCTGGAGGCTATGAAGAATGAACCAGAGGAGGGGATACA
GCAGATGACTGCCAAAATGGGGCCTCTCGCGGCGAACAACTCAGACCACTGCGCGACCTGCCAAAAGTCCATTGAGGATG
AATGCGCTAGGAACGGCGATAGCCGCTGGCATCTTGCCTGTGTGGCTTGTGTTCAGTGCGCGACTCCATTGGGCGCCAAG
CTGGGAGATGCCCGGGCTAGATATGACGGCTCCATACATTGCAACAGTTGCGAGCCATCCGATTCAGAGAAAGCCATACC
CTTAGATCGGGTCACCAAGCTGCAGCAGTATGTTTTTCTTCTACGGGTGGCTTTGGCCAGACTGCTGGACATTCTGTATT
CAAGCGGGGCGCTCTTGCAGTCTTCGGATGCGGCGGCTGCAGCAGCGAGAGACGAGTCCACGCCGTCCTCTGATGTGCAG
TCGCGAAGAGACGTACAGACCTCGACAAGTGGCGACCCTAATCGGCCGAGAGAGCCGTCTGCTTACGAGAACACGCTCAA
CGACGTTCGAAGGCTGCGGAGCACCCGTTTAGACAAACACCTGTCGTCGAGTTTCAAAAAAACACGGACATCCCGCGTGA
TGGACGGGCCAGAGGGCTCGGCTGCGCGGCCTGGCTCTTCCGGCGCAGAAAACGGACCGGCAAGCAGCGCCCGTCCCGGA
ATGCAGATTGTGGAGGACCGTGTGGACGAGGCTGCTGCGGACACAATGCTTGGCCATCAAGACTACCTCACTCTAGACGA
CATACCTCGCATCGTAGCGGCGGAGCAGGCTCGCGAGCAGCGACCTGGCGGACTCAACAACCGAGACTCGGTCATGGCCA
GGGGTGGTCAGCTGACGGCATACTCCAACGACCAATATGCCGCCGATGAACGGCAGGGCAAACCTACTGCGGCCGGTCCT
ACGATGATCTCTCCACACAAGCTTGGGGGGCGGAAGTATTTCTCTGAGCTGTCGGGCCTTGAGTATTTCATTGTGCGGCA
TCTGGCGGTGATGACTATGCAGCCGATGATCGAGAGCGAGTTCTCGCTGGAAGAACTGTTGGACTTCATCGAGTCTAGGA
AACCGGCGACATTCTGGAACAAGTTCGGCAAGGCGTTCAAGAACGACAACAAGAAGAATGTCAAGAAGAAGGGCATCTTT
GGCGTTCCACTCGAGATCATCATCGAGCGCGACGGGGCCGACTCCACGGACGGCGTCGGGCCTGGTACCCTGCGTATCCC
GGCCATCGTGGACGACATTGTGTCGACGATGCGGAAGATGGACCTGTCCGTCGAGGGCGTCTTCCGCAAGAACGGCAACA
TCAAGAAGCTGAGTGAACTGTGCGAGAAGATCGATCGGGACGGCTGTGACAACGTCAACTTGGGCGGCCAGAACGTGGTG
CAGGTGGCGGCTCTCTTGAAGCGATACCTGCGGGACCTTCCCGACCCATTGATGACGCACAAGCTGTATCGCCTCTGGCT
GGCCGCGGCCAAGATCTCGGACGAGGACCGGCGACGCCAGTGTCTCCACCTGACCTGCTGCTTGCTGCCCAAGTGTCACC
GCGACTGCCTGGAGATCCTGTTCTGCTTCCTCAAATGGGCCGGCTCCTTCCACCAGGTGGATGACGAGAGCGGCTCCAAG
ATGGATATCCGGAATCTGGCCACCGTCATCACTCCGAACATCCTTTTTCTCAGCTCAAAGGTGCCCGCTCTTGACAGCGA
CCCGATATTCGCTATCGAGGCCGTCTACGTACTGATCAACAATATTGAGGAGATGTGCTTGGTTAGTTTGGCGTGTTTCT
TTTATATCTTTCTAGCTCCTTCACATTCTAACTGCGTCAGGTTCCGGACGACCTAGTCGACGTCCTCAACGACCCGATGC
TGTTCAGCAACAACGGCGAGATCACGACAAAGGAAATCCTAAAGCGCTTCGGCGACCGGACAGGCAACAGTGCAGGTGGC
CGACCATACGGCCAGGTGGGCGAGGTTATGAACCGACACGACTCGACGACACGGCCGCTTGCGAGGCGCGTCGAGACGGA
TCCTTCGGTCTGGAAGGAAGAGACCAGTGTGCGTCCGGTGCAGGACGTACCAAACGGCAACAACAGTAACTTCCCGCCAT
ACAGCAGCGGTCCGAACCAGAGCTCGCCGACCAGGTGGCAGGGCCAGGACGAGCCGAAAGGCGTCACTCCGCCCTTCCAG
GCGCAGCACGAGCTTGCGGATCCGGACGGCCAGCTACAGGGTCCAGACCGCACGACTAAGCGAGAATGGCGGAACTCTGG
CTGGGTGCGAGGAAACAATGGTCCCCCAAGCAATGGCTCTGTTGGTGTTGCTGGCCATGGCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62