GenePrediction:GLEAN_953 Details

Name: GLEAN_953
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_146:127512..128568 (+ strand)
Length: 1057
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_146:127512..127526 (+ strand)
Length: 15
Type: CDS
Source: GLEAN
Position: GCSC_146:127790..128083 (+ strand)
Length: 294
Type: CDS
Source: GLEAN
Position: GCSC_146:128155..128568 (+ strand)
Length: 414
>GLEAN_953 class=GenePrediction position=GCSC_146:127512..128568 (+ strand)
ATGATGGCCTACGGAGTACGTCGTAAAGTGCCCTGCGAAGAAGATAGCCAGGGGGCGAGAGCACGGGCCCACATTGTATC
TCAGTGATAAGCAGGTTCCACAGCGGACCACTGACCCCAGCACGTTTCGCCACTGGACTGTGGCTGCTAGCGCCAATCGC
GAACTGCAAGCTGTCTTCCTTCGAGAGTGGTGAGAAAAAAGGACACGACAGAAAAAAGCGGTGGGTCCTTGGGCACGCGA
GCAACGATCACGAACGATTGCTATCCGACTGTTTTGAGAGCGCGCCGCTGCAGCTGCCTGTTCCCGCTTCTGCTGCCATT
GCACCGCACCGCAGCATCACTGCACCACAGCATCACCGCAACCCTTCTTCTGCAATGGCACGTCTCTTCTTCGGCCTGTT
GGCCGCTGCTGCCGCTCTGCTGCCGTCGGTCGCCGCCCACAACATCCAGCTGCCTGCGCATGGCCGCGAATGCTTCTTTG
AGGAGCTCCATCGCGACGATACGATGACGGTGACCTTCCAGGTGGGCGACCGCGAGTTTGGCGGCGCCGGCAACCTGGAC
ATTGATTTCTGGGTAGGCTTCCCTCTTTGCCCTCCAACCCCCCCCCCCCCCCTTCCGTGCTGACTGAGGCTCGTCTTGTG
CAGATCACGACCCCCAACGGCCAGTATGAGACCTTCCAGAAGACGACCTCAAACGGCGACTTCACCTTTAGCGCCCATTT
GGACGGCAAGTATCAATACTGCTTCAGCAACGAGCACTGGGGCGCGTCCAGCAAGGAGGTCTCCTTTAACGTGCACGGCA
TCGTGTACGTGTCCGAAGCCGACAGCCCCAAGGATCCGCTCGAGGCCGAGGCTCGCCGCCTGTCAGACCTGTTGGCCCAG
GTCAAGGACGAGCAGTCATACATTGTCGTGCGAGAGCGCACGCATCGCAACACGGCCGAGAGCACCAACAGCCGGGTCAA
GTGGTGGAACCTGTTCGTCATCGGCGTCGTCATCGGCGAGTCGGTCTTCCAGGTCTGGTGGCTGCGGCGCTTCTTCGAGG
TGAAGCGTGTCATCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62