GenePrediction:GLEAN_954 Details

Name: GLEAN_954
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_146:133793..134791 (+ strand)
Length: 999
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_146:133793..134618 (+ strand)
Length: 826
Type: CDS
Source: GLEAN
Position: GCSC_146:134679..134791 (+ strand)
Length: 113
>GLEAN_954 class=GenePrediction position=GCSC_146:133793..134791 (+ strand)
ATGGCATCATCGGATGCGTCTTGCTCCTCCTTTACGGCGCCCCCGAAGCCAGACCATTCCCCACTGAAGGCGTTACCATC
TGTTTCGGACCGCACAGCCATTGCCAACGATATCATGCTGAATATGGTCATCCGCCAGAACCCTTTCTCCATCACTCTGG
ACGCTCTTGCTATGCTGGTGGCTGCTCTCCTACTCGTCACTGGGATGCACGTTCTGCAGCCTAGCCTGCTCGAAGTCATC
ATAATCGCAGTGCCTCTGGTCTTACTTGTCCGCAATGATTACATTAACTTCCTGCTTCTCGGCCCAGGCGGCACACCACC
TACCTTTTCTGGTTATCTACGCCTGCTCTGGTTTCGCCTCTTCGCCCTGCGGGATGTTTACCACAGTCAGCCACCCTCAG
ATACGGTTCTTGCGCCCGCCGCCGGCATACTGAAAGAATTACCATATCGCCCTGGCCCGCGTCCCATCGTGGCCGGCCTG
GCACCACAGCGCCAACTGAACCAGCCAGCCTCGGGCAAATGCAACGTCGCCCTGCGCTCTGCCGTCGAGGACCTAACCCG
GCAGTACCCCGACAGCCTCTGTACAGCTACATCATGCATCGAGAAACACGGTTTCGGCCTGTTTGCGCGCCACCCCGTCA
ATGTTTGGGGTCAGGGTGAGGTTTTCCATATTCACGACTCGGAGAAGTCTATGCACATGAGCCTACACCCGGACGACATC
AAGGAGGTTCTCGAGAAGGGCTGGGGCCAGCGGCATCCACTGGCCTTCAAGGGCTGGGTTAAAGCACCGCTTCCCATTAC
TTTCGTCATGATCTATGCTCCGCGAGGTACGTATATTGGCGTCTGTAAACTATTTCAAAACTGAGTCTGCTGACTGACTA
TCCTAGATGAGAGTGATCTAAAAATTATCGCCAAGATCGTTGAGGCTGCCATTTGGTACACTATAGCCAAGGAGGTCAGG
CTGGAGATTCCACCTTTGAGCTCTCAAGAGTCTGCTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62