GenePrediction:GLEAN_955 Details

Name: GLEAN_955
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_146:139678..140588 (+ strand)
Length: 911
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_146:139678..139791 (+ strand)
Length: 114
Type: CDS
Source: GLEAN
Position: GCSC_146:140016..140351 (+ strand)
Length: 336
Type: CDS
Source: GLEAN
Position: GCSC_146:140436..140588 (+ strand)
Length: 153
>GLEAN_955 class=GenePrediction position=GCSC_146:139678..140588 (+ strand)
ATGTCGGCGGCACCCACGACGAAGAAGTTTGGCAAGTCCACCCGGACGGTGCCTCACCCCAGCCAGCGGGCCCAGAAGTG
GTACGCCGCAGAAGAGGACTCACAGCCGAAGAAGGTCAGTAGTGCCGGGAATGAGATGATGAGGAATACGAACAGAGAGC
AGATGGAAGCACATGTCATTGGCTATCAGTGCAGTGGAAGAAGGAGATGGGGCCAGGCGGCGGCAGTTGAGGTCCGACAG
GATCGAGACTGCCTAGACAGGGGCACCGGGCATGGAATGAACGGAACGGGAACCGAGTATTTGAGAGGCGCATCGCTAAC
GTATATTCTCCTGAACAGGTCCGCAAGGCCCTTCGCCCCTGGGCTCCACGCAAGTCCCTTCAGCCCGGCACGATCCTCAT
CCTCGTTGCTGGCCGCTTCCGCGGCAAGCGTGTCGTTCTCCTTAAGACGCTCGACCAGGGCCTGCTCCTGGTCACCGGCC
CCTTCAAGGTCAACGGTGTGCCGCTGCGGAGAGTGAACGCCAAGTACGTCATCGCGACATCCGAGAAGGTCGACCTGTCC
GGCGTGGACGCCAAGAAGATCGAGGAGATCGCCGCACCGAACTACTTCACCGCGGAGAAGGCGAAGGAGAAGGCCAGCGA
GGAGGCATTCTTCAAGCAGGGAGAGAAGCCCCAGGTAAGCTTTTTTCACGGGACACATCGCAGAACATCGACGAACGAGA
ATACAGGACAGGACAGGACGGCTAACCCCCCTTTGCAGAAGAAGGTCGTCCAGGCGACGCGCGCAGAAGACCAGAAGGCC
ATCGACAAGGCCATCATCGCAAACATCAAGAAGGTCGACCTGCTCAGCAGCTACCTCGCCACATCATTCAGCCTGCGCAA
GGGTGACAAGCCCCACGAGATGAAGTGGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62