GenePrediction:GLEAN_957 Details

Name: GLEAN_957
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_146:145248..145889 (+ strand)
Length: 642
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_146:145248..145394 (+ strand)
Length: 147
Type: CDS
Source: GLEAN
Position: GCSC_146:145455..145889 (+ strand)
Length: 435
>GLEAN_957 class=GenePrediction position=GCSC_146:145248..145889 (+ strand)
ATGACTGTCTCCAAAAGCAACGGCACGGTCCCCACTTCAGGCGACCACCATATCTGGCTGGTGACAGGGCCGGCTGGCAC
CGGAAAGACGACGCTGGCCACCTTCCTGGCCTCGAAGCTGGATGTGCCGTACATCGAGGGCGATGAGGTGAGTGGCTCGA
GACCTGCTTGGCTGCTTGGCCGACTCTGTAGTTGACATCCCCTCTAGTTTCACCCCCCAGCCAACATTGAGAAGATGCGC
GATGGCATCCCGCTCACCGACTCGGACCGTTGGGACTGGCTGACAGCCCTGCGCGAAGAATCGGTTCGCCGCATAACTGA
GGGGGGCAGCAGCTCCGTCGTGCTGACCTGCTCCGCCCTCAAGCGCAAGTACCGCGACGTCATCCGCGTGGCCCCCTACT
TCAACTCCAGCGTCCACGTTCATTTCATCTTCCTGCACGCCAGCGAGGATATCCTGCTGCAGCGCGTCTCCGGCCGCAAG
GGTCACTACATGGGCCCCGGCATGGTGCAGAGCCAGCTGGACATCCTGGAGCCGCCCAAGGAGGACGAGACGGACGTCAT
GTACGTAGACGTGGGGCGCCCGTTGGAGGAGATCGAGGCCGATATAATGCAGCGCGTTATGGGGACCAATGGAAATGCTT
AG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62