GenePrediction:GLEAN_958 Details

Name: GLEAN_958
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_146:148441..149317 (+ strand)
Length: 877
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_146:148441..148877 (+ strand)
Length: 437
Type: CDS
Source: GLEAN
Position: GCSC_146:148963..149317 (+ strand)
Length: 355
>GLEAN_958 class=GenePrediction position=GCSC_146:148441..149317 (+ strand)
ATGGTGGCGCGAACATTCACCAATGCGGCTCTTTCGGCTGGAAAGGCTGTCGGCCTCGGCGCCCCGCCATCTTCTTCATC
CATCCGGTCCTTGCGGCAGGACTCTTTTGCCGCCGTTCCATGTCTTCGGTGCCAGTGGCGAGCACTGAGCGTATCGCAGT
CGCGCAGAGACACAAAGGCAACGCCCACAAGCCAGTCAGAGCCGAAGGCCCCGGCTCTGGAGCTTGCCTCTGCTTCCTCG
CCAAGTCCGCTGGTAAATGTCCCTCGCTCCTACGGCGAGCGTCCTAAAGAATTCACGCCGACGCCGCTCTCCCGACCCAT
CGGTATGCCTCTGCCGCCGCTGGCCGGTGAAAACAGCGGAATTGACTTTCGGACTCTGCGCCAACGCCGTGACGACTTTG
TCGACTACGAGAAGCATCTAGTGCGAAGACAGGAGTTGTGCGTGCCCTGACTCCCAGAGGAAGCCAGCCTCTCATTGTTC
GTGCAACTCTCTCGACTGACCGCTGTCCTGCTTCTCCGCTAGGAAAAATAAAATCATCAAGCCCTACTTCCGCGACTGGA
CCAATCTCCAATTCCACAAAGGCAAGACGTTCATCGCGCCACCGCGTCTCTTCCGTGCCGATCTCTCGCTCTACTTCCCC
AACATCATGGGCGAGCGCCTGCTTTCTGCCGACAAGTCGGTCACCTCAGAGCTAGCGGACACGACTCCTATACTGCAGCA
GAGCGCTGCATCCGTGGTGGCCATGTTCAGCAGCCTATGGGCCGAGAACCAGGTCCGCAGCTTCGTATCGCCCGAGGCCA
ATCCAGCATTGGCGGAGCTGATCAACACACACCCCAAAAATGCGGCGGGAGGCGGAAGTGCCAACCGTTGCAGCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62