GenePrediction:GLEAN_95 Details

Name: GLEAN_95
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_179:652348..652697 (+ strand)
Length: 350
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_179:652348..652358 (+ strand)
Length: 11
Type: CDS
Source: GLEAN
Position: GCSC_179:652420..652557 (+ strand)
Length: 138
Type: CDS
Source: GLEAN
Position: GCSC_179:652613..652697 (+ strand)
Length: 85
>GLEAN_95 class=GenePrediction position=GCSC_179:652348..652697 (+ strand)
ATGTTGATCAAGTCCGTCCTCCGTCTCCCCGCCGCTGTCCTCTCCCAGCTAACCAGAGGACCAATCATTCAGGGTCCGAA
CGCTGACCGGCAAGGAGATCGAGCTGGATATCGATAGCGACTACAAGGTCTCCCAGATCAAGGAGAAGGTCGAGGAGAAG
GAGGGCATCCCGCCCGTTCAGCAGCGCCTCATCTACGGCGGCAAGCAGATGTACGTGCCTCTTTCGCTTCTTCTCTCCCC
TCCCTCTTCTTTACTGACGGTCTAGGGTCGACGACAAGACCGCGTCAGACTATGCGCTTGAGGGCGGCGCTACCCTGCAC
CTGGTTCTGGCCCTGCGCGGCGGCTTGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62