GenePrediction:GLEAN_960 Details

Name: GLEAN_960
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_146:151399..152227 (+ strand)
Length: 829
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_146:151399..151401 (+ strand)
Length: 3
Type: CDS
Source: GLEAN
Position: GCSC_146:151783..151922 (+ strand)
Length: 140
Type: CDS
Source: GLEAN
Position: GCSC_146:151996..152227 (+ strand)
Length: 232
>GLEAN_960 class=GenePrediction position=GCSC_146:151399..152227 (+ strand)
ATGGTACGTGGCTGCTGTCTTTTGCAACTTTCGCGCATAGATTTAGGCTGGGGGAGATGGGACTGGTTGTCGAGAAGCGC
TTCGCGAGTCAGTATCTTTCGCCTGTACGCTGCCGACACACTCGAATCACCCCACGATACAACAGCATCCCGATGACCAG
AGAGTACGGAAACTTGCAGCGCCGGCTCTGATACCGACGAAGACGACCTTCGCTACCACTTTCGAGACGGGCCCGGGGTA
CACGGCAGACCGGACATCGAAGCAAAGAAATTCTCAGAGAGGACAGCCAGGATGGGACGCACGGCCCGGGACTCTTTATT
TGCGTCGGCACTATGGAGAGAGAATGAAGCAGGGCGCTAACATGTATTTTGTGTGATCATGCAGTCTGTCAGCAAGGTTA
AGGCCGGCCAGCTGTGGCCGAAGAACAAGGATGAGCTCCTGAAGCAGCTCACTGAGCTCAAGACGGAGCTTGGCCAGCTG
CGCATCCAGAAGATCACCTCGTCTGGCTCGAAGCTGAACCGCATGTGAGTCTTGATTTCTGTCGTGGAGGCCAGATGGGG
GAAAGGGAATACAGACGGATGCTGACCTGATGTCTAGCCACGATGTCCGCAAGTCGATCGCCCGCGTCCTGACCATCATC
AACGCCAAGCAGCGGGCTCAGCTGCGTCTCTTCTACAAGAACAAGAAGTACCTGCCGCTGGACCTGAGAGCGAAGCAGAC
CCGTGCCATCCGCCGGCGGCTGTCCAAGGAGGACTCCTCGCGCAAGCTAGAGAAGACCAAGAAGCGGTTGTCGCACTTTC
CCCAACGCAGCTTTGCTGTCAAGGCATAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62