GenePrediction:GLEAN_961 Details

Name: GLEAN_961
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_146:156209..156630 (+ strand)
Length: 422
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_146:156209..156430 (+ strand)
Length: 222
Type: CDS
Source: GLEAN
Position: GCSC_146:156478..156630 (+ strand)
Length: 153
>GLEAN_961 class=GenePrediction position=GCSC_146:156209..156630 (+ strand)
ATGGGCAACCTCTGCGGCAAGGTCGACTCGGACGCCTTTGAACAGCCCGGGCGCGTTCTCGGAAGCGCAGACGCGGTGCT
GATCCCCGGACAGCCGCGCACTGCCGCCGTTCCACCGCAGGCTACTTTGAACCGCGTCGGCGGTCCACCACGGACGCTGG
GGGGCGAAGGCAGCTCCGGTGCAGCAGATGACGTGCGCAGGAAGGCAGCAGAAGCAGCTGAGGTGGGCTCTCTCATACTC
CCCCACTATCTCTCCCTCTAACACGGCAGGCCCGAAATGCACCCAAAAGCACCGGCAAGCTCGGCAGCAAGCTCGATGCT
CAGCGCAAGGAAAGCCGGATGGACACGCTGAAGAAAGCCAGCGCGGATGAAGTGCGACGACGCGAGATGGATGCGGCCGC
CCAGGCAACAAGCCACAATTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62