GenePrediction:GLEAN_962 Details

Name: GLEAN_962
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_146:161311..162441 (+ strand)
Length: 1131
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_146:161311..161907 (+ strand)
Length: 597
Type: CDS
Source: GLEAN
Position: GCSC_146:161971..162096 (+ strand)
Length: 126
Type: CDS
Source: GLEAN
Position: GCSC_146:162117..162275 (+ strand)
Length: 159
Type: CDS
Source: GLEAN
Position: GCSC_146:162337..162441 (+ strand)
Length: 105
>GLEAN_962 class=GenePrediction position=GCSC_146:161311..162441 (+ strand)
ATGTGGTCAGCCGTCCGCACGACCATAGGCCGAGGCCTGTTCAGCCCTGCGGTGGAGAGCAAGGTCTTCACCCCCGCAGC
TCGTCGCATTGCTACCGCATCCGCAGCCCGCGCCCCTCCACGGCCAAGAGGGACTCTCTGCGTGCCTCTGATCCAGTGCA
CAGAGAGCACTCAGACCCGTGGCTTCGCTGGCACGGCCACGGCGGCCGTGACTAAGGATACGGCAGCAACGACAAAGGCA
AAGAAGGCGCCGGCAAAGAAACCGGCAGCAAAGACAAAGGTAGCGGCAAAAAAGCCGGCTGCGAAGAAGCCAGCAAAGAA
AACGACGGCAGCCAAGAAGAAGGTGGCAGCCAAGAAGCCGGCTGAAAAGAAGCCCCGCAAGGTAAAGACGGATGAAGAGA
AGAAGCAGTTGAAGGTGCGGGAGCTCAAGAAGCTGGCGCTGCTCGATGAGCCCACCAGACTGCCGGAACGGTCCTGGGTC
ATGTACGTGTCGGAGAGGATCAAGGGTCAGAAGTTGAATGGCGACAAACACTCCATGGTCTCGACCATGCCGAGTCTCAG
CAAGGACTACAAGGATCTGTCGGAAATCGAGCTTCAGGTGAGCGCTGCTTCTCTTTTCGGTCCCTCCTCCTCGTAGCCAC
GTTCTGACCTCTTCCTGTAGCGGCTCCGTGATAGCGCCACCAAAAACATCGAGACCAATGCCGTGGCCTACAAGGCTTGG
GTCGAGAGCCATTCGCCAAAGGAAGTGGCCGAGGCCAATCGCGCGCGCGCGCAGCTCAAACGGCTCGTTGGCCTGACTCG
GCGCAGCATCCAGGATTCCCTCCAGCCAAAAGAGAATGCTGTCGGCATATGCTCTTTTCACCAAGTCGTGCTGGCAAAGG
GGCAAGTTCCACGGCGGGCCCCTCGCTGATTGCGGCCAAGGCTATCGCGGCCGAGTGGAAGGCCCTGCCCGAGTCGGAGC
GCCAGGTACGTTGTTCCAACCCGTGCAGCTCCTGCAACGCGTATAACTGACCCATGAACCTCACAGCCGTTCGAAGAAGA
AGCCAAGACCGACTTTGAGCGTTACGAGAAGGAGGTCAAGTCCGTCCTAGACCGGGTTGTCCTCAAGAGCTCTCCTCCGT
CCTCGCCTTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62