GenePrediction:GLEAN_964 Details

Name: GLEAN_964
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_146:166306..167616 (+ strand)
Length: 1311
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_146:166306..166377 (+ strand)
Length: 72
Type: CDS
Source: GLEAN
Position: GCSC_146:166456..167616 (+ strand)
Length: 1161
>GLEAN_964 class=GenePrediction position=GCSC_146:166306..167616 (+ strand)
ATGGCCGACAGGATTGCGACAGACGAAACCAGGCAGCGGCCGAGACGTGGCGAAGCGATTACGCTCGGGATTGTATGAGG
ACGAGGACGAATACGAGAGTACAGCAGGGGGCCGGGTTATTTGTTCAACGACGACGAGCTCGATCGGCAGCTGGACGACA
GTGGGCTTGTTGCGTCGCTGGCGGACGACCTATCGCTGCGCGACGTTGTACAGGCCCTGCGATATGCGCGGGCCAACATG
TTTGATCCGATTCCTGGGCACCAAGAGGGCGGCGGCAACGGCTTTGTGGGAAACAGTACCCGCGTGGCCGAGCTGCTCAA
TACAAGGCGGCGGCTACCGGCACTGGCAACGACGGCGCACGTGGCGGCACTGCTGCCGAATGCAACAGCGACGGAGCGGG
AAACGGTATCCCTGATGCGAGCGGGTATATTGCGCAAGGTTGTGCAGCCGCAGTGGCGGCGAGCCGGCGAGCCGTTGGGC
GAAGTCCTCGTGGAGACAGCCACGCTGGAGCAGCTCGTGAGAGATGGACCGGCGTCGAGTGAGGGTGATGGTCTGAGCGA
CGACACACAGGCAGCCTTTGTTGCCTGGTTGCGTGGTGAAGGGGGCGAAGAGCATGGAGGACGAGACCACAGCAGCCCCA
GAGCGATCACGATCCACGGTCAGACGGCACCACGGCTAGACGGTCGCATGGCCGACGAGCTGGTGCGTGCCGGCTTCCTG
GTCGGTCACGGAGCAAGACGAGTGGTGGATCATCGCAGTGGTGGCAGCGGCCAGAGCAACAACAGCAGCGAGAGGAGTGG
CCACGGCGACGTGTTTGCGCGGCCCGAAGACCGTACGTCGCTGCTTAGCCTCGAAACCGTGGCGAAGGCCGCGTCTGGCT
CCTTTGGCGCCGTCGGTGGCATCGGTGCCGTCTATACGGCCGGCGGTGGTGGTGCACGTTCGGCTCTGCCGTTGCAGACC
GGGTGTCAACAGAATGCTGCTGCATCTACGGAAGATCTCCTGCTGGCCGTCCCCGGCCACGGCGCCTTTGTCAAGCTCGT
GTCGGCGGCGCTGGCCCATCTCGTCAGCCTGCTGGCCCGCACACCATTCCGTGAGGCACCCGAAACGATGCTGCAGGAAC
GATGGAACGCTGCCGGCAGCAACTCTGGCGGTCATGGAAGCTACCGGCGAGTGACGCTGAGCCGCACCAGAAAATGGAAG
GACCTGTATGGTCTGAGCTTTAACTGGGTGCTGGCAGAGGCCGTGGGCGCCGGCCTGGTCGAGGTGTTCGAGACCGGCAG
TGTAGGGCGCGGAATACGGCTGCCGGCATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62