GenePrediction:GLEAN_965 Details

Name: GLEAN_965
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_146:168471..169054 (+ strand)
Length: 584
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_146:168471..168563 (+ strand)
Length: 93
Type: CDS
Source: GLEAN
Position: GCSC_146:168643..168768 (+ strand)
Length: 126
Type: CDS
Source: GLEAN
Position: GCSC_146:168788..169054 (+ strand)
Length: 267
>GLEAN_965 class=GenePrediction position=GCSC_146:168471..169054 (+ strand)
ATGCCAGCATATCCAGTCGCGTCCAGCCCGAAAGAGCACACTGCTGCACTGGCCCACTTTGAAGGACACGGAAGCTTCTT
CAGCATGTACGGAGTACGAGTACGAGCAGATGTGACAGGGCCAGCCGAGTGCTATCACACCTCCCTACTATGTATATTAG
CAACGTGGGTAGCCGCCTGTGGGCGAACAGACCGCGCAAATGCAAGTGCTGCCGGCCTGCGTAGGCGAGGAGGACCCGGG
AGCGCCAGAAAGGCGTGCGAGCATGTGCATGAGGCCCGGATGCGACGTACTCGGACTCGTCAGTTGCATCCCGACAGACG
CTTTGGGGTTTTCGCGAGATAACGCTCATGCAGGTACGGACAGCCACATGTGCTCGTATCCACGAGCCCAGATACTACGC
CGTACACAGTAAGATACTTTGCATGTACGGAGTACTCAACGACGCGTCCAAGTACGACTACTCGAGCAGCCAGTGGATAA
ATGTCCCGGCCCCTGGTCCCAATCCCCTGTCCAACGCATGCACGGACCTTGGCTTGGTCACGGAGGAAGGCCAAATGGAC
AGATGGATTGGACGGCGTGGTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62