GenePrediction:GLEAN_966 Details

Name: GLEAN_966
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_146:171918..175064 (+ strand)
Length: 3147
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_146:171918..172707 (+ strand)
Length: 790
Type: CDS
Source: GLEAN
Position: GCSC_146:172780..175064 (+ strand)
Length: 2285
>GLEAN_966 class=GenePrediction position=GCSC_146:171918..175064 (+ strand)
ATGGCCGCGGCCTTGCCAAGGTCTTTCAACGGCCCGCCATCAGCGGCACTTCCTGCACTTCCAGTGGGAAAAACTCGGAA
GAGCATAGGTGCCAATCCCCCTCCTACCCCAAGGACTAGCAGGGCAGCTCCTACCACACCGCGCAGCGGCCTACGTGCGC
CGTCCACGTCCGCTTTACCCGGCAATTTTCCGCAAAGTCTGGTACCAGGCCTACCTCGTTCCTCCTCTGGAGCCAACGCT
GCTGGGAAGACGTTACGGAAGACGGTCAGCATAAACTCTTTTCCTCAACCTCCAAGGTCAGACAACCGTATCACAAGTTT
GCCTCCGAGTCCCTTGTCAGCTGGTGCACCAACAAGCCGAAAACCGAAGACACCAACGACACCGAACTACACTTCGAGTA
ATTCAACACCGAGTCTCTTGAACGGAACTGGCGATGGCAGGTCCGTTGCACGCCCTGGCCATCGAAGCTCTGATGGCGTC
ATCAGTGTAGCTTCATTACCTCAAAGTCGAAGTTCATCCGCACAAGACTCCTACTCTACCTCGGCAACTCAGTACGACGA
CATTGGAGATAGCTCGGCAGGGCCCAGAAATGGCACTACTGTACCACCTACAGATGAAAGCAGCAACAATCACCAGTCAA
AGGGCGATGGCAAAGGCAACATCATTGTCAGCGTTCGAGTCCGGCCGGACGCCGGCGGCCGTGACAACAAAAGTGACGGC
GAGTGGATGGTAGATGGGCGCAAAGCCCTGGTGGCCTATGGAGGCAAGGAGGGTGGTGATTATTATTACGGTGAGTTTCT
CGTTGCGCACAGCCAGACAAATTCAAGCCAAAGGCTCTGTTGCTGATACATTTGCTTTGCAGACAACGTCTTTTCTACAC
ACGACAACAACTCAAAAGTCTACGACCATATCGCAAAGAGGCTAGTTCGCCGTGTCATGGAAGGCTATCATGGTACTGTG
TTTGCCTATGGCATGACCGGCACTGGCAAAACCTTTTCCATGCAAGGTACGGCTTCGTCTCCAGGCGTTATTCCACTGGC
CATTACCGATATCTTCTCCTACATTCGGGAAACACCGTCTCGCGAATTCTTGCTGCGCGTTAGCTACCTCGAAATCTACA
ACGAAAGAATCCACGATCTCCTCAGCATGTCGACAACTGGCGGCATCGGGCCAACAACACAGGATGAAATCAAGCTACGA
GAGGACAGCAAGCGAGGTGTATATGCAAGTCCGCTGAAGGAAGAAATCGTGCAGAGCCCAACACAGCTTCTACGCGTGAT
TGCTCGTGGCGACCAGGCTCGTCGAACAGCCAGTACACAGTTTAACTCTCGCAGCTCTCGCAGCCACGCAGTCGTTCAGA
TCGTGGTGGAGAGCCGCGAACGCAGCCCGGCTAATGCTACCGGGAGCGACAACAAGCGTGGCGGTCTTCTGCCAGGTGGC
GTTCGTGTGTCGACGTTGAGTCTGATCGATCTTGCCGGCTCTGAGAAGGCGGCCGAGTCCAAAGAGCGGCGCACAGAAGG
TTCCCATATCAATAAAAGCTTGCTCACGCTGGGAACTGTCATTTCAAAACTGTCCGAACACAAAGACAAAGATGGCAAGC
AAGCTGATAAGGACGGGAAGCATCTGCCGTATCGAGACAGCAAGTTGACACGGCTATTGCAGGGTGCATTGTCAGGCAAT
TCACTTGTCAGCATCTTGTGTACCATTCAAATTGGCTCTGCCGGCAGTGCTGCAGCATCGAACAGTCACACTACCGAAAC
GATCAACACGCTGAAATTTGCGTCGCGAGCGAAGAACAATCTCACCAGTCATGCCAAGCGAGCTGAAGAGGCCCTTGGAG
CTGGCGGCGATGGCGGCGCTCGAGTTCTACTGGAGCGATACCGTATGGAAATTCTTGAGTTACGTGCACAACTCGAGAGC
CAGGCAAAAGACAAGGACAGCGACAAGGGTAGCGGTAGCGGTAAAGACGACGAGGACCGAGTGCGAGATGTCGAGGAAGA
GCGCGCTCGTGAGCGAGAGGCAGAGAATCGGCATGAGGAGCAAATTCTCGAGATGCAACTCGCGCGAACGGCACTCAAGG
AGCGCATCGATCACCTGAACAGGCTAATTCTCAGCTCGAAGTCTACCGGCGTGAACACCGGTGGCACTTACAGCGCTTTG
GGTATACGGTCCTCCATAATATCTGTGCGTTCTATTGCGACAACCAACGCAGGGACTATGGCGAGTGGGAACAGATCGCT
TCTAGAGCGGACTGTGTCGACAACATCCTCATCGTCCACAATTGGCCGAAGAGTCAGTGAGCCTCCAACATCCGGTGGCC
GCACCGATTCTGCACCGGCAGAAGATGACGACATCGCCGGTGAATTTGGCGATGGTATAGCCTCCCTGTCATCACAAAAC
CAGGCACTTCAGGCGGATCTTGCGGATAAGAACCGTTATATTGCGATGTTGGAGAAACGATTACTGCAGGCAAGACGTGC
CAGCTCATCGAGAGCATCTGTTGGCCTGGGCTCGTCGAACAAGGGAATCATGGTCGGAGAAGACCACAGTGTGTCGGCGG
TGATCCGCGAAAAGGACGCGGAAATTTCAGAGCTTCGTGCCCGCCTGGACGATAAGGACCGCATGCTAGCCGCGTTGCGC
AGTGCGGCAAGAAACCGTGACAATGCCGACCGGGTAGAGTCTCGCATGGATTCGCGGATAGAATCGCGTCTAGATTCAAG
ACTGGAACACCGGCTAGACTCACGACTAGATTCACGACACGATTCGCGACTAGATATGCGGGCTGATGTTCGAACGTCGC
AAATGCTTGAACCGCCTAGCAGCCCACCAGTTATGGCGCTGCCACCCACACCCCAACCTCATGGGTCGATGTCAGACATG
AAGATGGCGCCACCTTCGAAGAGGATGAGCGCGGCCATGTTCCCGCGAGCCCGGAAGAAGAGTGTCGACGAGGTCAGCCG
GATGCTAGACGAGATGATCCAGGACCGCGTTGAAAGTGGCCACCTGGTCCGCGGTGTACGCGGCAGCGTCCGTGTACCGG
CTGAAAAGAAGGCCAATGCGCTGGCAGAGTCAGCAATGTCTTTGGAGCCGTTGCGACAGAGCCCGCCATTGGTTCCAGAG
GCAACACCCATGATTTTGGAGGCGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62