GenePrediction:GLEAN_968 Details

Name: GLEAN_968
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_146:180891..182619 (+ strand)
Length: 1729
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_146:180891..181136 (+ strand)
Length: 246
Type: CDS
Source: GLEAN
Position: GCSC_146:181209..181406 (+ strand)
Length: 198
Type: CDS
Source: GLEAN
Position: GCSC_146:181472..182193 (+ strand)
Length: 722
Type: CDS
Source: GLEAN
Position: GCSC_146:182250..182619 (+ strand)
Length: 370
>GLEAN_968 class=GenePrediction position=GCSC_146:180891..182619 (+ strand)
ATGGGTGTCTTTCAGGATGCGGCGGGGCCGCTGCTCGAGCAGTACTCGCAGCTGGGCATGGCCACGCAGATTGGTGTTGG
CGTCGTGGCAGCGCTCACCGTGATTGTGTTTCTGAACGTCGTTCAGCAGATTCTGTTCAAGAATCCCCATGAGCCACCAA
TGGTCTTCCACCTGTTCCCAATCATCGGTAGCACGATCACATACGGCATGGATCCTCCGCGCTTCTTCAAGGAGAACCGG
GCCAAGGTATGTGGACGCTCTTTGCATTCTGGCCGCGTTTGAAGCATTGGCTAACGGTTTGCTCTTTGTTTCCTGCAGCA
TGGTGATGTGTACACTTTCGTCCTGCTCGGCCGCAAGACCACGGTGTTCGTTGGGCCGACTGGCAACGATTTTATTCTCA
ACGGGAAGATCCGCGATGTGAGCGCTGAGGAGATCTACACCGTGCTCACGACGCCCGTGTTCGGCCGCGACGTGGTGTAC
GACTGCCCCAACTCCAAGCTCATGGAGCAGAAGAAGGTATGCGCTGCCGATGACTGTCTGCTGTCTGTGGTTGTCTCATT
CTGACCCAATCGTGTCGACAGTTCATGAAGTTCGCCCTGACGACTGAGGCATTCCGCTCCTACGTGCCCATCATCTGGGA
AGAGGTCAAGAGCTACTACAAGCGCACTGCGGACTTCAAGGGGCAGTCGGGCGGGGTCAACATCCCGCCCAAGATGGCGC
AGATCACCATCTTCACGGCATCGCACGCACTGCAAGGCAAAGAGGTCCGCAACCAGTTTGACGAGTCGCTGGCAGACCTG
TATCACGACCTGGACATGGGCTTCAGCCCGATCAACTTCATGCTTCACTGGGCACCGCTGCCTTGGAACAACCGGCGCGA
CCATGCGCAGCGCACGGTGGCCAAGATCTACACGGACACGATCAAGAGTCGGCGGGCAAGGGGCGAGACGAGCGCGCAAG
ATATCATGTTCCACCTGATGAACTCCACGTACAAGAACGGCACTCCGGTTCCGGACCACGAAATTGCGCACATGATGATC
GCGCTGCTGATGGCAGGCCAGCACTCATCGTCGTCGACCAGCTCTTGGATCATGGTTCTGCTAGCATCGCGGCCCGACGT
CATGGAGGACCTGTACAAGGAGCAGGTGCAGGCTCTCGGCGCAGACTTGCCGCCGCTGCAGTACGAGCATCTGGCTAAGC
TGCCGCTGCACGGCGCCATCGTCAAGGAGACCCTCCGGCTGTACGCCCCCATCCACTCGATCATGCGCAAGGTCAAGCAG
CCGATGGCGGTGCCTGGAACCAAGTATGTCGTGCCTACCAGCCACGTGCTCATGGCGGCGCCTGGTGTCTCAAGCAAAGC
GACCCGGTCTACTTCCCCAACCCGGACCTGTGGGACCCGTACCGGTGGACGAAGGACTCGCCCAATGCGCCGAATCTTGG
CCGCCCCGAGGAGGAGGACGACGAGAAGATCGACTATGGCTACGGTTTGGTCAGCAAGGGCTCCGCGTCGCCGTATCTGC
CATTTGGTGCCGGCCGTCATCGGTGCATTGGCGAGCAGTTTGCCAACGTGCAGCTGCAGACCATCATCGCCGAGACTGTG
CGGATGTTCAAGTTCCGTAATGTCGATGGCAGCAACAGTGTCATTGGCACTGATTATGCCTCGCTCTTTTCGCGGCCGCT
GGAGCCTGCTGTGATCCACTGGGAGCGTCGCGAGCAGGTCGCGCAGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62