GenePrediction:GLEAN_970 Details

Name: GLEAN_970
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_146:199829..203098 (+ strand)
Length: 3270
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_146:199829..199977 (+ strand)
Length: 149
Type: CDS
Source: GLEAN
Position: GCSC_146:200275..203098 (+ strand)
Length: 2824
>GLEAN_970 class=GenePrediction position=GCSC_146:199829..203098 (+ strand)
ATGGCGGCCTTTCTCAGCCATGATAGCTCACCTCTTGCCGAGGTAGCGCCCGTCAACATGGCGGTCGCTGAAGACGACTT
TGCAGAGCGCTCGTCGCCGCGTAATATCCCACCGCCTGTCACGATCCCCCCGCAGTCAAACGACAATCTGTGCGTCCCAA
TCTATTCGTCTACCTCCCAGATCTCTCGACATACACAACAGAATTCGCCGTTACCGATGCCGCCTTTCGTGTTTCCAGCC
AAACCGTCGACATCAGCCCCTTCGTCTTATTCACGTGCAACCGGAAGACGGCCAAAGTCGGTTGCAGACCTGCACGAGGG
GAGCACCTTCGCGGCCGGAGGCGCTAGAAGCCTTGACAACCGGTCACCGAGGCCCCTTGCATTACCCTTTTTTTCCTTCA
ATCCAGGCGCCGTTTTCCCGCCCACGCCTGACCATTCATTTCTCAGTCCTCCACTCTCGCCTCAGCCCTTTGGTGCTCTT
CCTATCCGCCCGGCTGGAGCTGGCCATCGCCGGGGAGGAAGTGAGTTCGTTGGTGGCAACGCTCGTTCTGGAGATGCGTT
TGCTCTTATCAGTACTAGCCCGACAAAGTCTGAGAGCAGCCTCACGTCGCCGTCCCTTGCACCTGTGCCCAGCTCTCGCG
GCCCCCCCCCCAATGGCCCCCCACCCGGTCGGCGTGGCCATGCCCACAGACGATCGGCAGCTATTTCGATCCACGACCTA
TCGGATATGCTGATTCCGACAACGCCAACCCACCAGACCCGTGGCAATAGCGCCCCATCCAGTCCGTTGGAGTTCGGCCC
CGGGCTGAAGGCCTTCGCCTTTCCGATGGCAACAAAATCCGACGACAAGCTCAAACCGGGTCCTTTGCCCCCCGTCGAAG
TCGTGAAACCCAACGATGTACCACCGGCCTCCTTGACACCCACATTTGTTTTCCCGGATGAGCCCGATCAACAATCTGCC
GACTTCAGAGCCTCTAATCGTGCTAGGGTTGGATTTTCCGACACTCTTGAGTTCATCCCTCGGCCTCTGTCCCTTGTCTC
CAATGACACAGCCAGCACAATCACCGCACGGCCCATGGCTGGAAGTAGTGGCACCTCTGGCCACTCCGTCTCTGAGAGCA
TCTCGTCGGTTATATCACTGAATTCGGCAGGCCTCACACCTATAGTCCGAAGCACTTCAAGTGGAACTGTGCCGGAGTCT
CGGCCCAGTACAGCTGGTGCTGTGCTGGAGCGTTCTCAAAGTATCACGGCCGACGATCCTGACAGCTCATTGCCCCGAAG
ACGCAACTCAATTCCTCTGCTTTCGTCTATTCCGACAGATTCGGAGCTATCGGCAGATGCTGCCACGAAAGGCGTTGCGC
CACGTCTCCCTAGTCCTATCAAGACGCCCAACAAACGATGGTCCTTTTTCGGCCTGGATCCTTTCATCACCATTGGCAAC
AGCTCACCAACACGACCACGGGCAGGAGCGGCGGAGGCCGTAGACGGGTCTGCGATTGCAGATGCTGCAGACGCGTCTTT
TACTGGCCCTGTGGCACTTGCGACGGCCCGAAGCCGATCCCTTGACAGGGATGCTGTGATTACGTCCAGACCGGCCTCTG
TGAGAACAGTGTCGCGGAAATCGAGCAAGAAGAAGAAGAAGGCAAAGAGCTGGGGAATCTTAACAAGGAAGTCGAAGGCG
CGGCGAAAGACTAGAAGAACGCCAACGCCTCCACCGATCTCGCAGACTGCCTTTAGCGATGACGAGGAATCTTTTGAGGA
GCAGACTTTTTCGGGGGGTACAATCGATGAGACTACCGAAGTCCTCGCACCTCCGACAGTGTTTGTCACTCCGTCTTATT
CACCGACCGATTCAGACAGCACAGCAGAGGCGTGGCGACTGCCTCCGTCGCCTTCATACAGCATGCCGGATGACGATGCT
TCTTTCGCCATGATCGACCTCGACGCGGCGCTTGGTCCCTTTAATACGCCTCTGCCACAAAATGCCGAGTGGGAGGCGGC
ACAGAGAGCCGGCGGAATGACGAAGCGGCAGCTGCACAGTGCCGTTGGCATGACCCGCTTCTCTGGACCCGGCATGCACT
ATTCCCACAGACGCGCGGAGAGTGCTCCTGAGATGCCACCATTCAATAGAGCCGGCCTCCCGAGATTTAGCAGCTCAGGT
GCAATGGCAGACGTCTTTGAAGAGGATGAAGAGGACGACGACGACGAGGGCAAAGGGAAGCGGCGCCAGATGCTTATGAC
AGCCGACAGTTCTGATGCTGGCTCTGTGGTCTATTCCGCTTCGGTAGGCGGAAGCACTCCGCCGTGGCGTCCTACACGGG
TGACCGAGCGAACGTCGAGCATCGACATTCGCGTGACGTCTACTGACGGCCGTGCTGCTGCGGACAAAGGGGTGGATATG
TCGACGGCGCCCAGCGAAGATGCCATATCCTCCGCTGCGCTGAGCAGGCGTGGCAGTGGGCTGAGCGTGATGAGTGACGA
CGACAAGACCCAGCTCAGCACTGGCCTGAAGTCTGAGTACTCAGCAAGCTCTCTTCATGAAGGTGCGAAAATGGAGGAAG
GGTTACGTGGCCCCCCTTTTGATGTTCCCGACAGCGGATGCGACGTTACGGTGGAGTCGGCGTCGGACTCGACCGTCCAC
TCGATTGGTCGTGTGAGGAAGGGCAAGGACCTGGCGCCCGTGGTTGTGATGATCGTGAGCCCGCTCCACCTTCCGCCTAT
GTCGCTGGCTCCTGTCAGCCCGTTCTCGATGCCAACAACTTCGACTCACCCGTCGCCACGGTCGCCGATGTCGCTTGAGG
CAAACCGCGTGTCGACGGCACCGTCGTCTGTCACAGAGGACAACTTCCAGTCGCTTTTGATGGGTGCGCCTGGGCCCGAG
CTCCGGCGGTCGCTCGACATCCCGTCTCTGACGCCGTCTCTGGCGAGCAGCACTTCGACGACAACGCGGGAGAGTGGAGT
TCCGCCATCTCTGCACACGGCGCAGGGACCTCAGACACGACCGTTTCTACCGTCTCGGGAAGCGGAACGGCCGGCGTCCT
TCACATATACGGCCTTTGGACGGCGGCGGTCGAGTCTGGCGAGTCTGCACCGGCTCATCAACACGTCCCATGGCGAGCGG
AGCAAGCTGTCGATGGAGGTGCCGCTGGACAGCAGCAGCATGCCTGAAACTGCTGAGGACGCAGAAAAGAAAAGGCCAAA
ATCCAGCCGCAGCAAGCGGCTAAGTCGGATGATGCAATTCTGGCGATCGAAAGGCGAGGCGGAGTCCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62