GenePrediction:GLEAN_971 Details

Name: GLEAN_971
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_146:204042..204729 (+ strand)
Length: 688
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_146:204042..204240 (+ strand)
Length: 199
Type: CDS
Source: GLEAN
Position: GCSC_146:204290..204729 (+ strand)
Length: 440
>GLEAN_971 class=GenePrediction position=GCSC_146:204042..204729 (+ strand)
ATGGCCAACACGCGCAGCGCCTCCCGACGGCTCCTGCGCGAGCTTGACGGGTGGCGCAAGGAGCAGCTGGCCGACTCCCC
GGACGACGACAACAGTCCGAACCGCGGCATCGAGCGTCTGGGGCCGGCTGGCGAAGGCGACGACCTGTTCCGCTGGGAGG
CCGTGGTGAACGGCAAGGGTGTTGGAGGGGGTTACGATGGTGAGTCTTGGTTCCTTTTCGGCTGTTTGATGCCTGGCTGA
CCGGTCAGACGGCCGCTGGCTTCTCCAGATCGACGTCCCGGCCACGTATCCGCTGCAGCCACCGGCTGTCCGGTTTATGA
CACCCATCCTCCACGCTAACGTGCATCCGACCACGGGCGCGGTCTGCCTCGATCTGCTGCAGGCATCGGCCTGGACACCG
GCCATGGGCGTCGCTGCCTGCGTGCGCGCCGTTCGCCTCCTGCTGGGCGCGCCTGGCGCCGACAGCCCGCTCAACATCGA
CTTGGCCGCACTGCTGCGTGCCGGCGACACCGACGCGGCCGCCCGGCTCGTCCGGCTCTGGTGCGTCGAACAGCGGTACG
AGGGCGCATCCCAACAGCGAACAGAGAGACTCAACCAATACGGCGCCGATCGGGGCGCCCGATGCAGAAACGTGGGTCCT
GGGTCCTGGGTCCTGGGCCCTGCGTCGTGGGTCGTCGCATACGGATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62