GenePrediction:GLEAN_972 Details

Name: GLEAN_972
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_146:207484..208494 (+ strand)
Length: 1011
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_146:207484..207493 (+ strand)
Length: 10
Type: CDS
Source: GLEAN
Position: GCSC_146:207611..208494 (+ strand)
Length: 884
>GLEAN_972 class=GenePrediction position=GCSC_146:207484..208494 (+ strand)
ATGGCCGATGGTGAGTCGTGGTTGCCCGTTGGATGAGAGAACACTCGCCATTGCCTTTGTAATCCACCGTGTGTACGGAG
TAATATGTAGACTGTTTTCCGAGATGGCTGGCAATGGGTCAAGACAGGCGGCCCCACTGCACAGACGATGCGGTTCGACA
AGGCTGTCGCGACAGCCTGCGGCTCATTTGCAGTCACCAACGTTGACGACTTGTTTGTGCTAGCGACCTTTTTCGCCGAG
GCGACAGCCGGCCGCAGCGGCCTGACACCGCTCAAGATCACGCTGGGCCAGTACTTTGGCTTCACCGGCATCATCATCGT
CAGCCTGGCTGGCTTTGGCGTGTCGCTCGTCGTGCCAGCCGAGCCGATCGGCTTTCTCGGCCTGGTCCCATTGCTGCTGG
GCATCTGGAAGTTGGCTGGCGCTATTGCCCCGGCAGGCGGGAATGCCGACGAGGAAGAGCCGCGAGAACAGCCGAACGTG
CGACAAGGAAAGACGTCTAGGACAGCCGGCGTCAGAAGCGTGCTCAAGGTGGCGGCCGTGACCATGATGAACGGCGGGGA
CAACGTGGGGACATACATCCCGCTGTTTTCGCAGGCCAGGGGGGCCGAGATTGTCGTGTACGCGGCCATGTACTACCTCA
TGCTCGGGCTGTGGTGTGCGGCTGCCTTTTTGGCCATGCGGCAGCAGCATGTCCTGCGCCTGGCCCGGAAGTACTCACGC
GTCCTGGTGCCGCTACTCTACACCGGCATTGGCACCTACATCATCGTCAAGTCGCAGTGCTATCCGTGGTCGGTTGCGCG
CATCGACCACTCGGTCTCTGGCCACCACGGAGCGACAATTTTGGCTGTTGCCACGACAGTCTTGTTGCTGACATATTTGG
GCGTTGTGCTATGGGTGAGGCTGCGCGCACAGCTACAAGCACTGGTGTTGCATGCTCGGACCCAAAGGCAGGAAGAAGAT
ACAGAGCTGCGAAGTCTCGAGGCGGATGGACACTGCCGAGATATCTGTTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62