GenePrediction:GLEAN_973 Details

Name: GLEAN_973
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_146:208835..209760 (+ strand)
Length: 926
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_146:208835..208969 (+ strand)
Length: 135
Type: CDS
Source: GLEAN
Position: GCSC_146:209041..209760 (+ strand)
Length: 720
>GLEAN_973 class=GenePrediction position=GCSC_146:208835..209760 (+ strand)
ATGGACGCTCTTGTTACTCGGTATAGCCGTCCGGCATTCCGGCAATGCGAGGATGTGGAAGATGTGGACGAGATGGACTA
CAATGACACGATGCCGGGTCTGTCGTTCAAGTTTGCCATGCCTCCGGTAGCACAGGTGGGTTTCAACTGTTGGTGAAGTG
AAGTGGATGCATTTGTGCCTTTGTCTCGACGTTGCTGACGTTGCAGCCGTCGGCCTGGTTGCGTGCGGCTACGGACGACC
GGTCCAACCCGACGTGCCCGATCAAGATTGCGCACGGCACGACGACGCTGGCGTTCCGGTTCCAGGGCGGCATCATTGTG
GCGACGGACTCGCGGGCGACGGCGGGCAACTGGATCGCATCGCAGACGGTCAAGAAGGTGATTGAGATCAACAGCTGTCT
GCTGGGGACGATGGCTGGCGGTGCAGCGGACTGCCAGTACTGGCTGGCGTGGCTGGGACGCGAGTGCCGGCTGCACGAGC
TGCGGCACAAACGGCGGATCTCAGTGGCGGCAGCATCCAAGATCCTGGCCAACCTGGTGTACAGCTACAAGGGCATGGGG
CTGTCGATGGGCACGATGTGTGCTGGCGTGACGCCCGAGGAGGGCCCGGCGCTGTACTACATCGACTCGGACGGCACCCG
GTTGGCGGGCAACCTCTTCTGCGTCGGGTCGGGCCAGACGTTTGCGTACGGCGTGCTGGACGCCGAGTACAGCTACGACC
TGGCGGCCGACGACGCGCTGGAGCTGGGCCGACGCAGTATCCTGGCGGCTACGCACCGAGACGCCTTTTCCGGCGGCTTC
ATCAACCTTTACCACGTCAAGGAGGACGGCTGGGTCAAGCACGGCTTTAGCGACACGAACCCCATCTTCTGGAAGACGAA
GTTGGAGAAGGGCGAGTTCTCCAACGTGACCAGTGCACTGGACTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62