GenePrediction:GLEAN_974 Details

Name: GLEAN_974
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_146:221567..223081 (+ strand)
Length: 1515
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_146:221567..221891 (+ strand)
Length: 325
Type: CDS
Source: GLEAN
Position: GCSC_146:222074..222362 (+ strand)
Length: 289
Type: CDS
Source: GLEAN
Position: GCSC_146:222418..223081 (+ strand)
Length: 664
>GLEAN_974 class=GenePrediction position=GCSC_146:221567..223081 (+ strand)
ATGCCTCTCTCACGAAGCCCATCACCAAGTCCTGGCGGCGGGTGGTCGAGTCCCGGTCTGAACATCCACGGCAGTGGCCG
GTCTAGTCCATCTCGAGGCTTCGGCGCGGACTCCAACGGGGCCGCATCTGGTGCTTGGGAGTCGACACGCTCTCGCAATG
CTGGGACAAGCAAATACCCTTCTTTCTCAACGCAAAACCAGGGCTTTTTTACCCGACATATGCGCCAGTTATCGAGCAGC
CTGCCTCGCTTCCACAACAACACCAGGCATGCCGACAAGGAAAAGCATGGCCACCACTTTGCGGAAGGGACGAATGCATC
GTGGGGTGGGCGCTTCCGACTCCTATTTGCACGCATGGGAAGAAAACTAAAGATTCGCGTCTTAATGGCCTCTTTGCTAT
TAATATGCGCCTACGTATTTTTCCACACCCGTGAGCACCCCTTTATCACCTATTTTGCTACTGCTTCTACTGGGAAAAAT
CACTAAATACTGACCTTTGAGTAACAGCTCTTCTGTATTACTGGCGGAGAACATCATGGCTAGGAGGCGGCGAGAAATTT
GTCATCATTTTGGCGGCAAACGTTGGAGGTGGCGTCATGGAATGGAAAGGTGCAAGAGAATGGGCGATCGAGAGGGATAG
CACGCGAAACAAGAAGCGATACGCCGCACGTTGGGGCTACGATCTAGAAATCGTGGACATGAGCACGAAGAAGCGCTATG
CGCACGAATGGCGCGAGAGCTGGGAGAAGGTCGATTTCATCCGACAAGCGTTGCGCAAATATCCCAATGCCGAATGGTGC
GTCTCGTCTCTATTAGCTGAATTGGAGCTGTGCTAACAAACTACTCTGCAGGTTTTGGTGGCTGGATTTGAACACTTATG
TCATGGAGCCGTCCTATTCGCTGCAGGACCACATATTCAACAACCTTCAGGACCACATTTACCGCGACATCAACGATTAC
AATCCACTGAACATCCCCCACCCGCTTAATGATCCATACCTGGACACGCTTTCTCGAAACGTGGCCGGTGATGGGAAGCC
GGATTCGGTCAATCTCGTCTTATCGCAGGACTGCTCTGGCTTCAATCTCGGTTCTTTCTTTATTCGCAAGAGCGAGTGGA
CCGATCGGCTCCTGGATGTATGGTGGGATCCCGTGGCTTATGAGCAGAAGCATATGGACTGGGAGCACAAGGAGCAGGAC
GCTCTGGAGCAGCTCTATATCGCCCAGCCGTGGATTCGCCAGCACACTGGATTTTTGCCGCAGCGGATGATCAACAGTTT
TCCCCAGGGCGCTTGCTCTGAGAACGGCAACAACACGCGTTATCACTATGACCAGAAGGACCGCGATTTTCTGGTCAACA
TGGCTGGTTGTGAGTGGGGCCGCGACTGCTGGGGCGAGATGTACAACTACCGCGAGTTGAGCTACTACCTCAACCGGTCG
TGGTGGGAACGATTTAAGGAGGATTTCCTCTGCATCGTTTGGTTCAAGCTCACTGGTCGAAAAGTCAAGCTCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62